Báo cáo khoa học: "’Boiled egg’ in the peritoneal cavity-a giant peritoneal loose body in a 64-year-old man: a case report" potx

... Access ’Boiled egg’ in the peritoneal cavity -a giant peritoneal loose body in a 64-year-old man: a case report Ajit Sewkani 1* , Aruna Jain 2 , KK Maudar 1 and Subodh Varshney 1 Abstract Introduction: Peritoneal ... cm, are rare and only a few cases are reported in the literature. These bodies are usually infarcted appendices epiploicae, which become de...

Ngày tải lên: 10/08/2014, 23:21

... 1–35) contains a small putative DNA-binding SAP motif (after SAF -A/ B, Acinus and PIAS) associated with proteins involved in chromosomal organization and DNA repair [27]. In this study we probed the validity ... replication intermediates. The dominant-negative effect of the mutants was not unex- pected. The catalytically inactive point mutants, in parti- cular, retain their f...

Ngày tải lên: 20/02/2014, 11:20

... in the guan- ine ring, at distances of  1.6 A ˚ (Fig. 2B). The carbonyl, a hydrogen-bond acceptor group of guanine, is replaced by a donor amino group in adenine, whereas the guanine amino at ... parameters of binding [39] as the subject of a separate investigation. In this regard, weak interactions in the adenine ring binding site have been identified in B. stearo...

Ngày tải lên: 16/03/2014, 01:20

... the follow- ing experiments. Words in italics indicate a class of words: “something” indicates that any word can appear, and disease indicates that any dis- ease expression can appear. These queries ... an- cestor/descendant relations in XML. For example, A > B” indicates that A is an ancestor of B. In [tag] Region covered with “<tag>” A > B A containing B A &g...

Ngày tải lên: 17/03/2014, 04:20

... even increased the solvation, owing to increased water-binding capacity. This may allow the protein to remain in a hydrated state, preventing the binding of inorganic cations in the high-salt ... PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢- CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢- GGATCCTCGAG CTCATTTACGTTTTAAATTAAT...

Ngày tải lên: 22/03/2014, 21:20

... the ANN– IAF–S1 or the ANN–FHS–S1. ADP binding had only minor effects on the temperature dependence of f¢ in the case of ANN–IAF or ANN–FHS pairs. In the case of the IAEDANS–FHS pair, ADP increased ... suggest that in the closed conformation the flexibility of the 50 kDa upper domain is further increased. The relative internal fluctuation of the 50 kDa upper doma...

Ngày tải lên: 23/03/2014, 15:21

... (table I [14]). For example, the maternal effect mea - sures the difference in effect of each maternal allele against the background of the paternal alleles. The interaction effect measures the ... of the prediction pedigree are the same as the paternal grandparents of the qtl pedigree. Therefore the pre - diction mother and the qtl father are full-sibs. Also, the...

Ngày tải lên: 08/08/2014, 14:20

... evince the fact that the greater volume of the gaster is occupied by the air sacs and that these sacs are separated at the medial line by a hard partition (the mediastinum) which safeguards against ... – a paired tracheal duct that extends the entire length of the air sacs. The endothelium of the air sacs is very anfractuous, thereby enlarging and strengthening the su...

Ngày tải lên: 11/08/2014, 00:22

... amino-acids (the only exception being AtOFP6 which contains aspara- gine). In subf. 6 the corresponding amino-acid in position 23 is mainly asparagine while in subf. 2 is arginine. The amino-acid in ... in controlling fruit shape in Solanaceae plants in general, and pepper in particular, as well as the changes in fruit quality in duced after grafting and perhaps th...

Ngày tải lên: 11/08/2014, 11:21

... Salamanca. Salamanca. Spain. 2 Department of Preventive and Community Dentistry. University of Granada. Granada. Spain. 3 Department of Biostatistics. University of Salamanca. Salamanca. Spain. Authors’ ... the interpretation of data. VP and GP performed the data analysis and helped to draft the manuscript. All authors read and approved the final manuscript. Competing interests The...

Ngày tải lên: 12/08/2014, 01:21