Báo cáo y học: " Spontaneous traumatic macular hole closure in a 50-year-old woman: a case report" docx

Báo cáo y học: " Spontaneous traumatic macular hole closure in a 50-year-old woman: a case report" docx

Báo cáo y học: " Spontaneous traumatic macular hole closure in a 50-year-old woman: a case report" docx

... Spontaneous traumatic macular hole closure in a 50-year-old woman: a case report. Journal of Medical Case Reports 2011 5:290. Submit your next manuscript to BioMed Central and take full advantage ... Ohba N: Spontaneous closure of traumatic macular hole. Am J Ophthalmol 2002, 133:230-235. 5. Minihan M, Goggin M, Cleary PE: Surgical management of macular hole...

Ngày tải lên: 10/08/2014, 23:21

4 268 0
Báo cáo y học: "Off-pump coronary artery bypass in poland syndrome with dextrocardia: case report" pdf

Báo cáo y học: "Off-pump coronary artery bypass in poland syndrome with dextrocardia: case report" pdf

... OPCABG in a case of Poland synd rome with dextrocardia and only the second case report of coronary artery bypass in Poland syndrome. Any concerns about an insufficient LIMA were addressed by use ... (LIMA) before using it as a conduit. In a recent arti- cle, Saad et al [5] reviewed coronary artery bypass in dex- trocardia. They found 10 off-pump cases while 14 cases used car...

Ngày tải lên: 10/08/2014, 09:21

3 414 0
Báo cáo y học: " Partial-thickness macular hole in vitreomacular traction syndrome: a case report and review of the literature" pps

Báo cáo y học: " Partial-thickness macular hole in vitreomacular traction syndrome: a case report and review of the literature" pps

... in a case of vitreomacular syn- drome with an impending macular hole. Giacomo and Andrea [5] repo rted a lamellar hole in myopic traction maculopathy. Our patient had idiopathic vitreomacul ar traction ... traction syndrome results in many com- plications, such as cystoid macular edema, macular pucker formation, tractional macular detachment, retinal blood vessel avulsi...

Ngày tải lên: 11/08/2014, 14:21

5 335 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

... TGCTTCATCTTG CTGACGTGTACGTGGGACT C27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGC C29 5A AAAATGGCCTACAGTTTA GCTCGGTACC W31 5A CAGAATC GCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT C32 6A GTCAAGGAAGAAGCATCTGAGA GCCTAGTCTAGATAT 234 ... AAATGAGCCCAACAAAG CCGAGAAAAACATT I9 7A- R9 8A AATTTGATGCTCGACAGGCT GCCGCGGAGACATGG W10 1A CAATCCGGGAGACA GCTGGTGATGAAAA F11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTT...

Ngày tải lên: 08/03/2014, 16:20

7 404 0
Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt

Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt

... Kimura Y, Sakata M, Naganawa M, Oda K, Miyatake R, Fujisaki M, Shimizu E, Shirayama Y, Iyo M, Hashimoto K: High occupancy of sigma-1 receptors in the human brain after single oral administration ... human brain at therapeutic doses, * Correspondence: furuse@asahikawa-rch.gr.jp 1 Department of Psychiatry, Asahikawa Red Cross Hospital, Asah ikawa, Japan Furuse and Hashimoto Annals of Genera...

Ngày tải lên: 08/08/2014, 23:21

3 404 0
Báo cáo y học: "Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis" pdf

Báo cáo y học: "Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis" pdf

... using a Nikon optical system illuminated by a fibre optic light source. Images were analysed and recorded with a Hitachi CCD digital camera. Microvascular damage was analysed and quantified using ... ventricular function, or if haemodynamically significant pericardial effusion was detected by echocardiography. A greater than four-fold eleva- tion of creatinine kinase accompanied by th...

Ngày tải lên: 09/08/2014, 07:20

11 397 0
Báo cáo y học: "Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia" docx

Báo cáo y học: "Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia" docx

... as 'sympathetically maintained pain' [5]. Naturally occurring sympathetic neurotransmitters are cate- cholamines known as norepinephrine, epinephrine, and dopamine. All three substances ... fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase (CO...

Ngày tải lên: 09/08/2014, 10:21

7 428 0
Báo cáo y học: "Inflammatory mediators and cartilage biomarkers in synovial fluid after a single inflammatory insult: a longitudinal experimental study" pps

Báo cáo y học: "Inflammatory mediators and cartilage biomarkers in synovial fluid after a single inflammatory insult: a longitudinal experimental study" pps

... horses and a transient inflammatory stimulus may limit Figure 2 Synovial fluid inflammatory mediators and matrix metalloproteinase activity in inflamed jointsSynovial fluid inflammatory mediators and ... joint inflammation on SF inflammatory mediators, MMP activity and cartilage biomarkers in healthy joints. In short, prostaglandin E 2 , substance P, bradykinin and MMP activity rise s...

Ngày tải lên: 09/08/2014, 13:22

8 480 0
Báo cáo y học: "Lipoprotein levels and cardiovascular risk in HIV-infected and uninfected Rwandan women" docx

Báo cáo y học: "Lipoprotein levels and cardiovascular risk in HIV-infected and uninfected Rwandan women" docx

... provided historical information including socio-demographics, medical and psychosocial history and symptoms, and experience of trauma during the 1994 Rwandan geno- cide. A physical examination and body impedance ... laboratory of King Faisal Hospital in Kigali, Rwanda using standard labora- tory methods. For 112 women lipid values were not available because of a lack of reagents at the...

Ngày tải lên: 10/08/2014, 05:21

6 343 0
Báo cáo y học: " Gut flora enhance bacterial clearance in lung through toll-like receptors 4" docx

Báo cáo y học: " Gut flora enhance bacterial clearance in lung through toll-like receptors 4" docx

... ketamine hydrochloride (100 mg/kg intramuscularly, Veterinary Laboratories, Wyeth-Ayerst Canada Inc., Mississauga, ON, Canada) and xylazine (5 mg/kg intramuscularly, Bayer Inc., Mis- sissauga, ... our da ta indicate that commensal flora play an important role in maintaining lung inflammation reaction against E.coli pneumonia through TLR4. Our data also imply that early enteral feeding to .....

Ngày tải lên: 10/08/2014, 10:20

8 270 0
Từ khóa:
w