Báo cáo y học: "Metastasis of a cecal adenocarcinoma to the prostate five years after a right hemicolectomy: a case report" pptx

... CAS E REP O R T Open Access Metastasis of a cecal adenocarcinoma to the prostate five years after a right hemicolectomy: a case report Fady R Youssef 1* , Leanne Hunt 1 , Pieter ... tomography scans. Conclusions: This case demonstrates a rare isolated hematogenous spread to the prostate from a primary cecal adenocarcinoma, several years after d...

Ngày tải lên: 10/08/2014, 23:21

... publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Competing interests The author declares that they ... for measuring s everity of the symptoms and their impact on a person’s life [3]. The scale evalu- ates and reflects subjective assessment of the primary featu...

Ngày tải lên: 11/08/2014, 03:21

... Oxide: Physiology, Pathophysiology, and Pharmacology. Pharmacol Rev 1991, 43(2):109-142. 23. Hawkins D, Abrahamse H: Phototherapy - a treatment modality for wound healing and pain relief. African Journal ... scale evalu- ates and reflects subjective assessment of the primary features, intensity, and frequency of the disorder and associated sleep problems as well as the impact of...

Ngày tải lên: 11/08/2014, 07:20

... territory of Parma and a series of Na- ture Reserves in the province of Parma as well as parks, wildlife sanctuaries, state forests are all pro- tected areas. The total population is about ... Parma’s ham, sausages, and pork increases the inci- dence of toxoplasmosis. The Inflammatory and Autoimmune Ocular Diseases Service of Parma University Hospital is a reference...

Ngày tải lên: 03/11/2012, 11:11

... cerevisiae is a genetically more tractable yeast than C. albicans, it was chosen as a model fungal system for studying the glyoxylate cycle by analysing the subcellular distribution of malate synthase ... peroxisomal compartment, whichintheyeastSaccharomyces cerevisiae additionally representsthesolesiteforfattyacidb-oxidation. The sub- cellular location of the key glyoxylate-c...

Ngày tải lên: 22/02/2014, 04:20

... pUC19-VprYU-2 as a matrix by site- directed mutagenesis with specific primers: L23F-F ACACTAGAG CTTTTT GAGGAGCTTAAG, L23F-R CTTAA GCTCCTCAAAAAGCTCTAGTGT, K27M-F CTTTTAGAGG AGCTTATG AGAGAAGCTGTTAG, ... envelope is mediated by the interaction with the nucleoporin hCG1. J Biol Chem 2002, 277:45091-8. 29. Nitahara-Kasahara Y, Kamata M, Yamamoto T, Zhang X, Miyamoto Y, Muneta K, Iijima S,...

Ngày tải lên: 13/08/2014, 05:22

... therapeutic use of warfarin and ibuprofen may affect haem transfer to hemopexin and consequently its plasma level. In parallel, haem may affect pharmacokinetics of drugs carried out by HSA. ACKNOWLEDGEMENTS The ... subdomain IIIA) is preferred by aromatic carboxylates with an extended conformation. Remarkably, ibuprofen, a nonsteroidal anti-inflammatory agent [12], and warfarin, an a...

Ngày tải lên: 31/03/2014, 23:20

... disease of air- way smooth muscle, asthma is currently defined by the National Heart, Lung, and Blood Institute as a chronic inflammatory disorder of the airways in which many cells and cellular ... Saskatchewan, Royal University Hospital, Saskatoon, Saskatchewan; D. D. Marciniuk—Lung Association of Saskatchewan COPD Professorship; D. W. Cockcroft—Lung Association of Saskatchewa...

Ngày tải lên: 08/08/2014, 20:23

Ngày tải lên: 08/08/2014, 21:20

... oligoarthritis and 13 patients with enthesitis- related arthritis. The mean age of patients with JIA was 8.5 years (range, 2–15 years) and the mean disease duration was 26.2 months (range, 7–60 months). The ... was amplified using the following primers: 5'-ATAGCCTGCAC- CCAGATTGTAG-3' (forward primer) and 5'-AGAGACA- GAACAGCCCAACAC-3' (reverse primer). The PC...

Ngày tải lên: 09/08/2014, 08:22