Báo cáo y học: "Metastasis of a cecal adenocarcinoma to the prostate five years after a right hemicolectomy: a case report" pptx
Báo cáo y học: "Metastasis of a cecal adenocarcinoma to the prostate five years after a right hemicolectomy: a case report" pptx
... CAS E REP O R T Open AccessMetastasis of a cecal adenocarcinoma to the prostate five years after a right hemicolectomy: a case reportFady R Youssef1*, Leanne Hunt1, Pieter ... tomography scans.Conclusions: This case demonstrates a rare isolated hematogenous spread to the prostate from a primary cecal adenocarcinoma, several years after definitive treatment and excision. ... Surg Pathol 2003, 27:303-310.doi:10.1186/1752-1947-5-223Cite this article as: Youssef et al.: Metastasis of a cecal adenocarcinoma to the prostate five years after a right hemicolectomy: a case...
- 3
- 243
- 0
Báo cáo y học: "Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case repor" ppt
... publication of this case report and any accompanying images. A copy of the writtenconsent is available for review by the Editor-in-Chief of this journal.Competing interests The author declares that they ... for measuring s everity of the symptomsand their impact on a person’s life [3]. The scale evalu-ates and reflects subjective assessment of the primaryfeatures, intensity, and frequency of the ... eneral health status as“good”. Her activity level was “reasonably active"; shewalked in the mornings and did some occasional yoga.She did not complain of any mobility decreases andenjoyed...
- 5
- 318
- 0
Báo cáo y học: " Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case report" docx
... Oxide: Physiology, Pathophysiology,and Pharmacology. Pharmacol Rev 1991, 43(2):109-142.23. Hawkins D, Abrahamse H: Phototherapy - a treatment modality forwound healing and pain relief. African Journal ... scale evalu-ates and reflects subjective assessment of the primaryfeatures, intensity, and frequency of the disorder andassociated sleep problems as well as the impact of the symptoms on a patient’s ... usual rapid anddramatic improvement of the symptoms [6]. Otherdrugs, such as opioids (methadone, hydrocodone),GABA analogue (gabapentin, pregabalin), and ben zodia-zepi nes (clonazepam) are...
- 5
- 227
- 0
Báo cáo y học: "Incidence of Ocular Zoonoses referred to the Inflammatory and Autoimmune Ocular Diseases Service of the University of Parma - Italy"
... territory of Parma and a series of Na-ture Reserves in the province of Parma as well as parks, wildlife sanctuaries, state forests are all pro-tected areas. The total population is about ... Parma’s ham, sausages, and pork increases the inci-dence of toxoplasmosis. The Inflammatory and Autoimmune Ocular Diseases Service of Parma University Hospital is a reference Centre for the ... also as the food valley”. The characteristics of the environment, the presence of woods and the habit of consuming sausages and raw meat make Parma Province an endemic area for both arthropod-...
- 2
- 447
- 0
Tài liệu Báo cáo Y học: Targeting of malate synthase 1 to the peroxisomes of Saccharomyces cerevisiae cells depends on growth on oleic acid medium pptx
... cerevisiae is a genetically more tractable yeastthan C. albicans, it was chosen as a model fungal system forstudying the glyoxylate cycle by analysing the subcellulardistribution of malate synthase ... peroxisomal compartment,whichintheyeastSaccharomyces cerevisiae additionallyrepresentsthesolesiteforfattyacidb-oxidation. The sub-cellular location of the key glyoxylate-c ycle enzyme malatesynthase ... of the glyoxylate cycle take place in the cytosol: the splitting of isocitrate into succinate a nd glyoxylate, and the dehydrogenation of malate to oxaloacetate (Scheme 1).Fig. 3. Subcellular...
- 8
- 444
- 0
Báo cáo y học: "Localization of HIV-1 Vpr to the nuclear envelope: Impact on Vpr functions and virus replication in macrophages" potx
... pUC19-VprYU-2 as a matrix by site-directed mutagenesis with specific primers: L23F-FACACTAGAG CTTTTTGAGGAGCTTAAG, L23F-R CTTAAGCTCCTCAAAAAGCTCTAGTGT, K27M-F CTTTTAGAGGAGCTTATGAGAGAAGCTGTTAG, ... envelopeis mediated by the interaction with the nucleoporin hCG1. JBiol Chem 2002, 277:45091-8.29. Nitahara-Kasahara Y, Kamata M, Yamamoto T, Zhang X, Miyamoto Y, Muneta K, Iijima S, Yoneda Y, Tsunetsugu-Yokota ... Terminator kit (Amer-sham) and a Genetic Analyzer (ABI3100 Applied Biosys-tems).Yeast two-hybrid assay The library of HIV-1 Vpr mutants fused to LexABD and the two-hybrid screening procedure of...
- 15
- 186
- 0
Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx
... therapeutic use of warfarin and ibuprofen may affect haem transfer to hemopexin and consequently its plasma level. In parallel,haem may affect pharmacokinetics of drugs carried out byHSA.ACKNOWLEDGEMENTS The ... subdomain IIIA) is preferred byaromatic carboxylates with an extended conformation.Remarkably, ibuprofen, a nonsteroidal anti-inflammatoryagent [12], and warfarin, an anticoagulant drug [12], areconsidered ... most of the antioxidant capacity of human serum, either directly or bybinding and carrying radical scavengers, or by sequesteringtransition metal ions with pro-oxidant activity. Finally, HSAacts...
- 7
- 549
- 0
Báo cáo y học: "Role of Leukotriene Receptor Antagonists in the Treatment of Exercise-Induced Bronchoconstriction: A Review" pot
... disease of air-way smooth muscle, asthma is currently definedby the National Heart, Lung, and Blood Instituteas a chronic inflammatory disorder of the airwaysin which many cells and cellular ... Saskatchewan,Royal University Hospital, Saskatoon, Saskatchewan; D. D. Marciniuk—Lung Association of SaskatchewanCOPD Professorship; D. W. Cockcroft—Lung Association of Saskatchewan Ferguson ProfessorshipCorrespondence ... acti-vation, antigen-antibody interaction, and physicalstimuli such as cold) activate cytosolic phospho-lipase A 2 to liberate arachidonic acid from mem-brane phospholipids.5 The liberated arachidonicacid...
- 5
- 663
- 0
Báo cáo y học: "Lack of association between mannose-binding lectin gene polymorphisms and juvenile idiopathic arthritis in a Han population from the Hubei province of China" docx
... oligoarthritis and 13 patients with enthesitis-related arthritis. The mean age of patients with JIA was 8.5 years (range, 2–15 years) and the mean disease duration was26.2 months (range, 7–60 months). The ... wasamplified using the following primers: 5'-ATAGCCTGCAC-CCAGATTGTAG-3' (forward primer) and 5'-AGAGACA-GAACAGCCCAACAC-3' (reverse primer). The PCRs wereperformed in a ... study included 93 patients withJIA and 48 healthy children. All patients were diagnosedaccording to the International League of Associations forRheumatology (ILAR) classification criteria for...
- 4
- 318
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật