báo cáo khoa học: "Nasopharyngeal cancer mimicking otitic barotrauma in a resource-challenged center: a case report" docx

... Open Access Nasopharyngeal cancer mimicking otitic barotrauma in a resource-challenged center: a case report Adekunle Daniel * and Ayotunde James Fasunla Abstract Introduction: Nasopharyngeal cancer ... dis- ease [9]. This was not done in our patient because naso- pharyngeal cancer was not in our list of differentials. In astudybyGrandawaet al.of40patientswithnas...

Ngày tải lên: 10/08/2014, 23:21

... receptor activation. Case presentation: We present a case of intra-abdominal abscess formation mimicking disease progression, in a patient with metastatic renal cell carcinoma during sunitinib treatment. Conclusion: ... during sunitinib treatment Vasiliki Michalaki* 1 , Nikolaos Arkadopoulos 2 , Agathi Kondi-Pafiti 3 and Constantine Gennatas 1 Abstract Background: Renal cell ca...

Ngày tải lên: 09/08/2014, 03:21

... suggestions; and to Dr Valeria Cafaro, Aurora Bracale, Antonella Antignani and Sonia Di Gaetano for preparing some of the RNase variants used in this study. This work was supported by the Italian Association for ... described in Table 1. They are cationic proteins with cytotoxic activ- ity: BS-RNase [10] is a natural dimeric RNase; RNase- AA [21], RNase-AA-G [21], and RNase-AA-GG [22] a...

Ngày tải lên: 19/02/2014, 06:20

... promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGAT- CCCGCGAAATTAATAC and TEHA8: ACACCCATGG- TATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI...

Ngày tải lên: 06/03/2014, 01:20

... 803–806. 14 Bagramyan K, Mnatsakanyan N, Poladian A, Vassilian A & Trchounian A (2002) The roles of hydrogenases 3 and 4, and the F0F1-ATPase, in H2 production by Escherichia coli at alkaline and acidic ... reducing activity. Indeed, a decrease in E h7 was linked to an increase in exofacial thiol groups (Fig. 5A, phase 1) and the E h7 ceased to decrease and remained stable wh...

Ngày tải lên: 22/03/2014, 21:21

... progress can be determined. In a ddition, some zymogen preparations may contain more than 5% of a ctive contaminating enzyme. In these cases, the initial-rate assumption becomes impractical, and alternative ... autocatalytic activation of zymogens plays a key role in the regulation of many integrated metabolic systems in living organisms, a detailed kinetic analysis for the au...

Ngày tải lên: 23/03/2014, 13:20

... defining the unique properties of ovarian CSCs remains a high priority for developing early diagnostic and effective therapeutic strategies against ovarian cancer. Abbreviations 5-aza-dC: 5-aza-deoxycytidine; ... University Campus, Pune 411007, INDIA Email: Nicholas B Berry - nicholas.berry.phd@gmail.com; Sharmila A Bapat* - sabapat@nccs.res .in * Corresponding author Abstract Aggress...

Ngày tải lên: 20/06/2014, 07:20

... 1986, 25 ,591-600. 16. Sivakumaran, K., Calder, M. and Rajamahendran, R. The influence of reproductive status of bovine on oocyte number and maturation in vitro and the effect of coculture systems on fertilization and ... active production as a basis for producing additional embryos and calves and thus circumvent infertility. Ovaries obtained from abattoir still constitute an economical s...

Ngày tải lên: 07/08/2014, 17:22

... 83–85 Anatomical study on true hermaphroditism in an Indian pig ( Sus Scrofa Domesticus ) Neelam Bansal 1, *, K.S. Roy 1 , D.K. Sharma 2 , Rajnish Sharma 3 1 Department of Veterinary Anatomy & ... Ludhiana-141004, India 3 Department of Veterinary Public Health, College of Veterinary Science,Punjab Agricultural University, Ludhiana-141004, India A pig was confirmed to be a true herma...

Ngày tải lên: 07/08/2014, 18:21

... arising from the greater omentum: Case report Masashi Miguchi, Yuji Takakura * , Hiroyuki Egi, Takao Hinoi, Tomohiro Adachi, Yasuo Kawaguchi, Manabu Shinomura, Masakazu Tokunaga, Masazumi Okajima, ... T, Takahashi A, Asakawa H, Uehara A, Kohogo Y, Suzuki T: Malignant intestinal schwannoma: a case report and a review of the literature in Japan. Intern Med 1995, 34:1101-1105. 7. Tel...

Ngày tải lên: 09/08/2014, 01:24