báo cáo khoa học: "Partial tetraplegic syndrome as a complication of a mobilizing/manipulating procedure of the cervical spine in a man with Forestier’s disease: a case report" pot
... 5:529 http://www.jmedicalcasereports.com/content/5/1/529 Page 2 of 4 CAS E REP O R T Open Access Partial tetraplegic syndrome as a complication of a mobilizing/manipulating procedure of the cervical spine in a man ... prior to the procedure, as our patient already knew about his underlying degenerative disease. Case presentation We present the case...
Ngày tải lên: 10/08/2014, 23:20
... Physical damage is the mechanical breakage of a stem by an animal (due to tramping, scraping, push- ing, biting or boring for example) or by material falling from a higher ... This can probably be explained by the greater resistance of these individuals in the con- trol parcels as compared to the treated parcels in the early years...
Ngày tải lên: 08/08/2014, 23:22
... (PKC, ARF and RhoA) that stimulate it directly [14–18], interactions involving other proteins, such as actin, protein kinase N, casein-kinase-2-like serine kinase and amphiphysin, Keywords hydrogen ... Involve- ment of protein kinase C in the phosphorylation of 46 kDa proteins which are phosphorylated in parallel with activation of NADPH oxidase in intact guinea-pig poly- mo...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf
... Sequence TC4 CGGTCCTATTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTTCTAGG TC6 CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGG TC8 CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGG TC10 CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGG TG6 CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG TG8 CGGTCCTAGTACTC...
Ngày tải lên: 20/02/2014, 03:20
Tài liệu Báo cáo khoa học: "Minimal Recursion Semantics as Dominance Constraints: Translation, Evaluation, and Analysis" pptx
... Alex Lascarides, and Dan Flickinger. 2001. An algebra for semantic construction in constraint-based grammars. In Proceedings of the 39th Annual Meeting of the Association for Computational Linguistics, ... alternative analysis for the above constraint is given in Fig. 8. The constraint adds an additional argument handle to “and” and places a dominance edge from this handle...
Ngày tải lên: 20/02/2014, 15:21
Báo cáo khoa học: "Extracting Narrative Timelines as Temporal Dependency Structures" ppt
... temporal informa- tion extraction models formulate temporal linking as a pair-wise classification task, where each pair of events and/or times is examined and classified as having a temporal relation or ... written, adding links between each pair of adjacent events, and label- ing all links with the relation BEFORE. • ClassifySeq : A model that links each pair of adjacent ev...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: "Chinese sentence segmentation as comma classification" ppt
... f8=IP+IP 5. The conjunction of the ancestors, the phrase la- bel of the left sibling, and the phrase label of the right sibling. The ancestor is defined as the path from the parent of the comma to the ... corpus external to our training and test data. 1 4. The phrase label of the left sibling and the phrase label of their right sibling in the synta...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: "Partial Matching Strategy for Phrase-based Statistical Machine Translation" pptx
... substitu- tion. The advantage of our approach is that we alle- viate the data sparseness problem without increasing the amount of bilingual corpus. Moreover, the par- tially matched phrases are not necessarily ... alignment a. arrived in Prague last evening arrived in arrived in Thailand yesterday Figure 2: An example of phrase translation. Figure 2 shows an example....
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: "UNDERSTANDING SCENE DESCRIPTIONS AS EVg~NT SIMULATIONS " pot
... areas of language analysis, including syntax, semantics, and pragmatics. For example, consider the following sentences: ($I) I saw the man on the hill with my own eyes. (32) I saw the man ... peripheral factors can be influential in Judging the plausibility of an event. At the same time, I am aware that the effect in this case is rather weak, that people ca...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: "Natural Language Generation as Planning Under Uncertainty for Spoken Dialogue Systems" pptx
... supervised learning of dialogue policies from fixed datasets. Computational Linguistics (to appear). Srinivasan Janarthanam and Oliver Lemon. 2008. User simulations for online adaptation and knowledge- alignment ... Press. Marilyn A. Walker, Candace A. Kamm, and Diane J. Litman. 2000. Towards developing general mod- els of usability with PARADISE. Natural Language Engineering, 6(3). Ma...
Ngày tải lên: 08/03/2014, 21:20