0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Partial tetraplegic syndrome as a complication of a mobilizing/manipulating procedure of the cervical spine in a man with Forestier’s disease: a case report" pot

báo cáo khoa học:

báo cáo khoa học: "Partial tetraplegic syndrome as a complication of a mobilizing/manipulating procedure of the cervical spine in a man with Forestier’s disease: a case report" pot

... 5:529http://www.jmedicalcasereports.com/content/5/1/529Page 2 of 4CAS E REP O R T Open AccessPartial tetraplegic syndrome as a complication of a mobilizing/manipulating procedure of the cervical spine in a man ... prior to the procedure, as our patientalready knew about his underlying degenerative disease. Case presentationWe present the case of a 56-year-old Caucasian man with Forestier’s disease also known ... benefits of cervical spine manipulation may be outweighed by the possibility of further injury. Case presentation: We present the case of a 56-year-old Caucasian man with Forestier ’s disease who...
  • 4
  • 319
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Physical damage on tropical tree saplings: quantification and consequences for competition through height growth in a neotropical rain forest of French Guiana" pdf

... Physical damage is the mechanical breakage of a stem by ananimal (due to tramping, scraping, push-ing, biting or boring for example) or bymaterial falling from a higher ... This canprobably be explained by the greaterresistance of these individuals in the con-trol parcels as compared to the treatedparcels in the early years after logging,where ... diameter classes) atParacou in the control parcels [3, 10]. The number of Goupia glabra saplings increasedsteadily on treated parcels after logging andsilvicultural interventions...
  • 16
  • 260
  • 0
Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

... (PKC, ARF andRhoA) that stimulate it directly [14–18], interactionsinvolving other proteins, such as actin, protein kinase N,casein-kinase-2-like serine kinase and amphiphysin,Keywordshydrogen ... Involve-ment of protein kinase C in the phosphorylation of 46kDa proteins which are phosphorylated in parallel with activation of NADPH oxidase in intact guinea-pig poly-morphonuclear leukocytes. ... min. The lysate was spun downat 50 000 g for 15 min. The supernatant was mixed with pre-equilibrated anti-HA affinity matrix and rocked at 4 °Cfor 2 h. The lysate ⁄ matrix was pelleted and washed...
  • 9
  • 401
  • 0
Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

... SequenceTC4CGGTCCTATTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTTCTAGGTC6CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGGTC8CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGGTC10CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGGTG6CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGGTG8CGGTCCTAGTACTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGTACTAGGTG10CGGTCCTAGTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTACTAGGTG11CGGTCCTAGCTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTAGCTAGGB. ... SequenceTC4CGGTCCTATTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTTCTAGGTC6CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGGTC8CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGGTC10CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGGTG6CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGGTG8CGGTCCTAGTACTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGTACTAGGTG10CGGTCCTAGTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTACTAGGTG11CGGTCCTAGCTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTAGCTAGGB. Ge´ron-Landre et al. ... (TG8) in the presence of different amounts of the pY plasmid. The quantity of plasmid is indi-cated, as well as the signal to noise ratio (S ⁄ N).Fig. 6. Padlock stability on linear DNA. Plasmid...
  • 10
  • 371
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Minimal Recursion Semantics as Dominance Constraints: Translation, Evaluation, and Analysis" pptx

... Alex Lascarides, and DanFlickinger. 2001. An algebra for semanticconstruction in constraint-based grammars. In Proceedings of the 39th Annual Meeting of the Association for Computational Linguistics, ... alternative analysis for the above constraint is given in Fig. 8. The constraintadds an additional argument handle to “and” andplaces a dominance edge from this handle to “avail-able.” In fact, the ... ande,x,yavailableeprop a x a ycafeteriaxsaunayande,x,yavailableepropϕ1ϕ2Figure 7: An MRS for A sauna and a cafeteria areavailable” (top) and two of sixteen merging config-urations (below). a x a ycafeteriaxsaunayande,x,yavailableepropFigure...
  • 8
  • 332
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Extracting Narrative Timelines as Temporal Dependency Structures" ppt

... temporal informa-tion extraction models formulate temporal linking as a pair-wise classification task, where each pair of events and/or times is examined and classified as having a temporal relation or ... written, adding linksbetween each pair of adjacent events, and label-ing all links with the relation BEFORE.• ClassifySeq: A model that links each pair of adjacent events, but trains a pair-wise ... 4.2) are compared to these baselines.6.1 Evaluation Criteria and MetricsModel performance was evaluated using standardevaluation criteria for parser evaluations:Unlabeled Attachment Score (UAS)The...
  • 10
  • 332
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Chinese sentence segmentation as comma classification" ppt

... f8=IP+IP5. The conjunction of the ancestors, the phrase la-bel of the left sibling, and the phrase label of the right sibling. The ancestor is defined as the path from the parent of the comma to the ... corpus external to ourtraining and test data.14. The phrase label of the left sibling and the phrase label of their right sibling in the syntac-tic parse tree, as well as their conjunction, e.g,f6=IP, ... our paper.2 Obtaining dataTo our knowledge, there is no data in the publicdomain with commas explicitly annotated based onwhether they mark sentence boundaries. One couldimagine using parallel...
  • 5
  • 328
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Partial Matching Strategy for Phrase-based Statistical Machine Translation" pptx

... substitu-tion. The advantage of our approach is that we alle-viate the data sparseness problem without increasing the amount of bilingual corpus. Moreover, the par-tially matched phrases are not necessarily ... alignment a. arrived in Praguelasteveningarrived in arrived in ThailandyesterdayFigure 2: An example of phrase translation.Figure 2 shows an example. In fact, we create a translation template dynamically in ... encountering un-seen phrases in a source sentence, we search par-tially matched phrase pairs from the phrase table.Then we keep the translations of the matched partand translate the unmatched part...
  • 4
  • 268
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "UNDERSTANDING SCENE DESCRIPTIONS AS EVg~NT SIMULATIONS " pot

... areas of language analysis, including syntax, semantics, and pragmatics. For example, consider the following sentences: ($I) I saw the man on the hill with my own eyes. (32) I saw the man ... peripheral factors can be influential in Judging the plausibility of an event. At the same time, I am aware that the effect in this case is rather weak, that people can accept this sentence without ... cases the physical meanings may provide important metaphors for understanding the abstract world, w~ile in other cases the same mechanisms that are used in the interpretation of the physical...
  • 6
  • 290
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Natural Language Generation as Planning Under Uncertainty for Spoken Dialogue Systems" pptx

... supervisedlearning of dialogue policies from fixed datasets.Computational Linguistics (to appear).Srinivasan Janarthanam and Oliver Lemon. 2008. Usersimulations for online adaptation and knowledge-alignment ... Press.Marilyn A. Walker, Candace A. Kamm, and Diane J.Litman. 2000. Towards developing general mod-els of usability with PARADISE. Natural LanguageEngineering, 6(3).Marilyn Walker, S. Whittaker, A. ... Franc¸ois Mairesse, andRashmi Prasad. 2007. Individual and domain adap-tation in sentence planning for dialogue. Journal of Artificial Intelligence Research (JAIR), 30:413–456.Steve Whittaker, Marilyn...
  • 9
  • 300
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM