báo cáo khoa học: "Ultrasound-guided thrombin injection for the treatment of an iatrogenic hepatic artery pseudoaneurysm: a case report" ppt

... Selective arter- iography may also sho w active bleeding and anatomic variations such as an anomalous or replaced hepatic artery [6], and can be used in simultaneous diagnosis and treatment. The recent ... hemobilia with selective hepatic artery embolization. J Vasc Intervent Radiol 1995, 6(5):793-798. 10. Yamakado K, Nakatsuka A, Tanaka N, Takano K, Matsumura K, Takeda K: Trans...

Ngày tải lên: 10/08/2014, 23:20

... result of the endovascular manipulation. Uniform global enhancement of the renal parenchyma was noted. There were no signs of active contrast extra- vasation or opacification of an aneurysmal cavity. The ... identifying the PA (which usually appears as a round or oval structure arising from the main renal artery or one of its branches) and the potential to achieve...

Ngày tải lên: 11/08/2014, 02:21

... showed bilateral occlusion of her internal carotid artery in the intracranial position, pre-bifurcation and angiodysplasia in the cervical segments of the internal carotid artery. Sixteen days after ... cerebral arteriography showed bilateral occlusion of her internal carotid artery in the intracranial position, prebifurcation and angiodysplasia in the cervical segments...

Ngày tải lên: 10/08/2014, 23:20

... provides a clear explanation for the inability of P450scc to cleave the side chain of vitamin D3. Hydroxylation of the side chain of cholesterol at the adjacent carbons C22 and C20, to produce 2 0a, 22R-dihydroxycholesterol ... synthesis by the human placenta. Placenta 26, 273–281. 2 Guryev O, Carvalho RA, Usanov S, Gilep A & Esta- brook RW (2003) A pathway for...

Ngày tải lên: 18/02/2014, 17:20

... of the European Chapter of the Asso- ciation for Computational Linguistics, EACL-94, pages 34-40. B~atrice Daille, I~ric Gaussier and Jean-Marc Lang,. 1994. Towards Automatic Extraction of ... extracted as candidate terms: (Bourigault, 1992) extracts maximal-length noun phrases and their subgroups (depending on their grammatical structure and position) as candidate terms....

Ngày tải lên: 22/02/2014, 03:20

... was amplified from E. coli K12 genomic DNA, includ- ing a C-terminal HA tag, using primers 5¢-GCGCGCGA ATTCATGAGCATTATTAAAGAATTTCG-3¢ (forward) and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC ATCATAAGGATAACCACCAGGAGAGCGGTTATTC TGCTCTTTC-3¢ ... were 5¢-AGCAGAATAA CTGCTCTCCTGGTG-3¢ (forward) and 5¢-CACCAGGAG AGCAGTTATTCTGCT-3¢ (reverse), and those for MscL F54C were 5¢-GGGATCGATTGCAAACAGTTTGC-3¢ (forw...

Ngày tải lên: 07/03/2014, 02:20

... multilingual SLDS and initially it is able to hold dialogues in Spanish, Catalan, as well as in Latin American Spanish. Moreover the user can change the language at any particular moment of the conversation. ... by a Kernel and an increasing amount of modules or subdialogues. Another important advantage of AGORA is its infrastructure that facilitates the fast generation of...

Ngày tải lên: 24/03/2014, 03:20

... An AIR is defined as an ambiguous intermolecular dis- tance (d iAB ) with a maximum value of typically 2 A ˚ between any atom m of an active residue i of protein A( m iA ) and any atom n of both active ... picture of the interface than CSP data, which can suffer from ‘false positives’ because of conformational changes. Other relatively easily obtainable NMR parameters...

Ngày tải lên: 30/03/2014, 15:20

... strain rate imaging Strain means deformation and strain rate means deforma- tion rate [7]. Myocardial strain rate reflects how fast re- gional myocardial shortening or lengthening occurs, and is ... and is calculated from myocardial Doppler velocities (V 1 and V 2 ) measured at two locations separated by a distance (L) [8]. Strain rate equals the instantaneous spatial velocity gradient an...

Ngày tải lên: 29/06/2014, 11:20

... 40% of patients had relief for at least 12 months, and mean duration of pain relief was 14 months. Barlocher et al. 1 treated 50 patients with cryorhizotomy of the medial branch. At 1-year ... the joint allows better de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone and capsular tissue. Limitations of the curre...

Ngày tải lên: 26/10/2012, 09:32