báo cáo khoa học: "Aberrant DNA methylation of cancer-related genes in giant breast fibroadenoma: a case report" docx

... Marzese et al.: Aberrant DNA methylation of cancer- related genes in giant breast fibroadenoma: a case report. Journal of Medical Case Reports 2011 5:516. Figure 2 Immunostaining of ERa protein. The ... carcinoma. Int J Cancer 2005, 114:414-421. 6. Chintamani , Khandelwal R, Tandon M, Yashwant K, Kulshresthal P, Aeron T, Bhatnagar D, Bansal A, Saxena S: Carcinoma de...

Ngày tải lên: 10/08/2014, 23:20

... equally prevalent in ma les and females while SLE has a 1:9 male to female ratio, which also argues against a shared pathogenesis. This includes a potential role of estrogens which clearly contribute ... consent was obtained from the patient at adult age for publication of this case report and any accompanying images. A copy of the written consent is available for review by...

Ngày tải lên: 10/08/2014, 23:20

... deposits in a background of amorphous degenerating fibrinous material. Only a few cases of this rare lesion have been reported in the available literature. Clinico-pathological differentiation of this ... female: a case report Ruchika Gupta 1 , Milind Hote 2 , Ruma Ray 1* Abstract Introduction: Cardiac calcified amorphous tumor is a rare, non-neoplastic intra-cavity cardia...

Ngày tải lên: 11/08/2014, 07:20

... and all authors read and approved the final manuscript. Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser 1 , Martin ... stimulation: a case report Journal of Medical Case Reports 2011, 5:540 doi:10.1186/1752-1947-5-540 Nathalie Douay-Hauser (nathalie.douay-hauser@bch.aphp.fr) Martin Koskas (martin.ko...

Ngày tải lên: 10/08/2014, 22:20

... residual calcium may be seen [2]. One case of a recurrent cardiac CAT in a young patient has also been reported [3]. Another patient, a 60-year-old woman, had a fatal outcome of a cardiac CAT involving right ... details 1 Department of Pathology, All India Institute of Medical Sciences, Ansari Nagar, New Delhi - 110029, India. 2 Department of Cardiothoracic and Vascula...

Ngày tải lên: 11/08/2014, 03:21

... tumor was a uterine leiomyoma of maternal origin which became entrapped in the placenta and finally lost its attachment to the uterine wall entirely during pregnancy. Uterine leiomyomas can influence ... Verdebout JM, Barlow P, Thomas D, Hoorens A, Goossens A: Hepatocellular adenoma of the placenta: report of a case associated with maternal bicornuate uterus and fetal renal d...

Ngày tải lên: 11/08/2014, 17:21

... 5'–AGGACCCTGGATGTGACAGC–3'; HVR2: 5'–GCTTTCCACACAGACATCATAACAA–3'; CD: 5'–CTTACACTATTCCTCATCACCCAACTAAAAA–3'), reverse primer (ß-actin: 5'–TGGCATTGCCGACAGGAT–3'; ... 5'–TGGCATTGCCGACAGGAT–3'; HVR2: 5'–GTTTAAGTGCTGTGGCCAGAAG–3'; CD: 5'–GGAGTAGAAACCTGTGAGGAAAGG–3') and TaqMan MGB hybridization probes (ß-actin: 5'...

Ngày tải lên: 09/08/2014, 09:21

... a study of chimeric forms of DPP IV has shown that the luminal domain of DPP IV carries dominant apical sorting information while the short cytoplasmic tail and the transmembrane domain contain ... X & Zhang G (2003) Tyrosine kinase and tyrosine phosphatase participate in regulation of interactions of NMDA receptor subunit 2A with Src and Fyn mediated by PSD-95 after transi...

Ngày tải lên: 19/02/2014, 07:20

... for transconjugants plates were incubated for 2 weeks in anaer- obic jars using the GasPack (BBL, Kansas City, MI, USA) or AnaeroCult (Merck, Rahway, NJ, USA) systems. Escherichia coli strains were maintained ... derivative was cloned into T. roseopersicina, resulting in HTMG. Similarly, the HUVMG strain contained a 64-amino acid fragment of hupUV. Both the hupT and the hupUV mutant s...

Ngày tải lên: 16/03/2014, 23:20

... mainstay of therapy for intussusception in adult patients. Increasingly, laparoscopy is replacing open operations as the preferred approach. Diagnostic laparos- copy may assist in the diagnosis of intussusception ... (31%) and albumin (2.6 g/dL) levels. A plain abdominal radiograph showed a nonspecific gas pattern in the bowel with fecal loading of the descending and sigmoid c...

Ngày tải lên: 09/08/2014, 04:21