báo cáo khoa học: "Aberrant DNA methylation of cancer-related genes in giant breast fibroadenoma: a case report" docx

... Marzese et al.: Aberrant DNA methylation of cancer-related genes in giant breast fibroadenoma: a case report. Journal of Medical Case Reports 2011 5:516.Figure 2 Immunostaining of ERa protein. The ... carcinoma. Int J Cancer2005, 114:414-421.6. Chintamani , Khandelwal R, Tandon M, Yashwant K, Kulshresthal P, Aeron T,Bhatnagar D, Bansal A, Saxena S: Carcinoma developing in a fibroadenoma ... CAS E REP O R T Open AccessAberrant DNA methylation of cancer-related genes in giant breast fibroadenoma: a case reportDiego M Marzese1,2, Francisco E Gago2,3, Javier I Orozco2,3, Olga...

báo cáo khoa học: "Pigmented villonodular synovitis of the hip in systemic lupus erythematosus: a case report" pptx

... equally prevalent in ma les and femaleswhile SLE has a 1:9 male to female ratio, which alsoargues against a shared pathogenesis. This includes a potential role of estrogens which clearly contribute ... consent was obtained from the patientat adult age for publication of this case report and anyaccompanying images. A copy of the written consent isavailable for review by the Editor -in- Chief of thisjournal.AcknowledgementsThe ... synovial proliferation appears in dark grey in the T2-weightedimage at the same location. Bone or cartilage did not displayerosions or thinning, respectively.Anders Journal of Medical Case Reports...

Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" docx

... deposits in a background of amorphous degenerating fibrinous material. Only a few cases of this rarelesion have been reported in the available literature. Clinico-pathological differentiation of this ... female: a case reportRuchika Gupta1, Milind Hote2, Ruma Ray1*AbstractIntroduction: Cardiac calcified amorphous tumor is a rare, non-neoplastic intra-cavity cardiac mass composed of calcium ... mummi-fication and calcification and mimic cardiac CAT. Theabsence of predisposing c onditions for thrombosis, lack of characteristic laminations of an organizing thrombusand infrequent presence of...

báo cáo khoa học: "Diagnosis and management of an immature teratoma during ovarian stimulation: a case report" ppsx

... and all authors read and approved the final manuscript. Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser1, Martin ... stimulation: a case reportJournal of Medical Case Reports 2011, 5:540 doi:10.1186/1752-1947-5-540Nathalie Douay-Hauser (nathalie.douay-hauser@bch.aphp.fr)Martin Koskas (martin.koskass@bch.aphp.fr)Francine ... the article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon.Diagnosis and management of an immature teratoma during ovarian stimulation:a...

Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" potx

... residual calcium may be seen [2]. One case of a recurrent cardiac CAT in a young patient hasalso been reported [3]. Another patient, a 60-year-oldwoman, had a fatal outcome of a cardiac CAT involvingright ... details1Department of Pathology, All India Institute of Medical Sciences, AnsariNagar, New Delhi - 110029, India.2Department of Cardiothoracic andVascular Surgery, All India Institute of ... sub-continent.Wedescribethecaseofarightatrialmass,whichproved to be a CAT on histopathology. The case isbeing reported for its rarity and lack of reports in theIndian literature. Case presentation A4 0-year-oldwomanofIndianoriginpresentedwithhistory...

Báo cáo y học: " Smooth muscle tumor of the placenta - an entrapped maternal leiomyoma: a case report" docx

... tumor was a uterine leiomyoma of maternal originwhich became entrapped in the placenta and finally lost itsattachment to the uterine wall entirely during pregnancy.Uterine leiomyomas can influence ... Verdebout JM, Barlow P, Thomas D, Hoorens A, Goossens A: Hepatocellular adenoma of the placenta: report of a case associated with maternal bicornuate uterus andfetal renal dysplasia. Histopathology ... from other intrauterineabnormalities. For instance, in cases of undeterminedintrauterine tumors, demonstration of the fetal waveformsstrongly suggests a chorangioma, while maternal wave-forms...

Báo cáo khoa học: "Mitochondrial DNA alterations of peripheral lymphocytes in acute lymphoblastic leukemia patients undergoing total body irradiation therapy" ppt

... 5'–AGGACCCTGGATGTGACAGC–3'; HVR2: 5'–GCTTTCCACACAGACATCATAACAA–3'; CD: 5'–CTTACACTATTCCTCATCACCCAACTAAAAA–3'), reverse primer (ß-actin: 5'–TGGCATTGCCGACAGGAT–3'; ... 5'–TGGCATTGCCGACAGGAT–3'; HVR2: 5'–GTTTAAGTGCTGTGGCCAGAAG–3'; CD: 5'–GGAGTAGAAACCTGTGAGGAAAGG–3') and TaqMan MGB hybridization probes (ß-actin: 5'–AAAGACACCCACCTTGAT–3'; ... extra-nuclear DNA. Thus, besides nuclear nDNA, mitochondrial DNA (mtDNA) is equally affected as an only extra-nuclear genome [1-2]. Numerous investigations showed that mtDNA can be an easily available...

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

... a study of chimeric forms of DPP IV has shown that the luminaldomain of DPP IV carries dominant apical sortinginformation while the short cytoplasmic tail and thetransmembrane domain contain ... X & Zhang G (2003) Tyrosine kinaseand tyrosine phosphatase participate in regulation of interactions of NMDA receptor subunit 2A with Srcand Fyn mediated by PSD-95 after transient brainischemia. ... Protein content of fractionswas determined by a modiﬁcation of the Bradford methodusing BSA as a standard. Statistical analysis wasperformed with statview (Abacus Concepts Inc.,Berkeley, CA).Electron...

Báo cáo khoa học: Hydrogen independent expression of hupSL genes in Thiocapsa roseopersicina BBS pot

... fortransconjugants plates were incubated for 2 weeks in anaer-obic jars using the GasPack (BBL, Kansas City, MI, USA)or AnaeroCult (Merck, Rahway, NJ, USA) systems.Escherichia coli strains were maintained ... derivative was cloned intoT. roseopersicina, resulting in HTMG. Similarly, theHUVMG strain contained a 64-amino acid fragment of hupUV. Both the hupT and the hupUV mutantstrains had comparable ... with E-value of 5.4e-12) in its C-ter-minal domain. The HupR architecture was determinedusing the SMART database, revealing that T. roseo-persicina HupR contained a response regulator receiverdomain...

Báo cáo khoa học: "Mantle cell lymphoma of the gastrointestinal tract presenting with multiple intussusceptions – case report and review of literature" docx

... mainstay of therapy for intussusception in adult patients. Increasingly, laparoscopy is replacing openoperations as the preferred approach. Diagnostic laparos-copy may assist in the diagnosis of intussusception ... (31%) and albumin (2.6g/dL) levels. A plain abdominal radiograph showed a nonspecific gas pattern in the bowel with fecal loading of the descending and sigmoid colon. A CT-scan of the abdomen ... gastrointestinal tract [10].MLP can present with symptoms such as abdominal pain,diarrhea, bleeding, and less frequently, protein-losingenteropathy, intestinal malabsorption, or chylous ascites.Rarely,...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ