báo cáo khoa học: "An osseous lesion in a 10-year-old boy with Hodgkin’s lymphoma: a case report" ppsx

... in a 10-year-old boy with Hodgkin’s lymphoma: a case report Machiel van den Akker 1* , Vadiem Zudekov 2 , Asher Moser 3 and Joseph Kapelushnik 3 Abstract Introduction: Osseous involvement of Hodgkin’s ... Hodgkin lymphoma. Pediatr Blood Cancer 2008, 51:198-203. doi:10.1186/1752-1947-5-511 Cite this article as: van den Akker et al.: An osseous lesion in a 10-year-...

Ngày tải lên: 10/08/2014, 23:20

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...

Ngày tải lên: 14/02/2014, 14:20

... visualized by staining with Coomassie brilliant blue [45] or silver [46]. The protein concentration of samples was determined according to the Lowry method [47], with BSA as a standard. Purification ... enzyme was incubated with 1.5% N-lauroylsarco- sine at 68 °C for 20 min. After cooling to 20 °C, (NH 4 ) 2 SO 4 was added to a saturation of 68%. After 2 h of incubation at 20 °C, the...

Ngày tải lên: 18/02/2014, 17:20

... oligomer and blotted against c 1 antibodies. Lane 4: ATP synthase was incubated for 10 min at 80 °C, and blotted against c 1 antibodies. Lane 5: the sample was incubated for 10 min at 80 °C and hybridized ... synthes- ized at a rate of about 40 mol ATPÆ(mol pro- tein) )1 Æmin )1 . When a DY was applied separately, ATP was synthesized at a rate comparable to that with electrochemical s...

Ngày tải lên: 23/03/2014, 09:20

... genetically marked by a rare biochemical allele was released in a small, isolated natural population in tropical Africa. Surprisingly, only a slight, short-term modification was ... close vicinity of the banana baits. Prior to release, a sample of native flies was taken to determine the allelic frequencies in the natural population. Another...

Ngày tải lên: 09/08/2014, 22:23

... recall and precision rates. By default, the ALEPH algorithm only generates rules that have 100% accuracy for the training data. And each rule contains at most three predicates. To accommodate ... to allow rules that have above 50% accuracy and contain up to ten predicates. De- fault parameters were applied for all the other set- tings in ALEPH as well as other learning algorithms used in...

Ngày tải lên: 20/02/2014, 09:20

... 2007. Large language mod- els in machine translation. In Proceedings of the 2007 Joint Conference on Empirical Methods in Nat- ural Language Processing and Computational Natu- ral Language Learning ... translation. In Proceed- ings of AMTA. Sylvain Raybaud, Caroline Lavecchia, David Langlois, and Kamel Sma ¨ ıli. 2009. New confidence measures for statistical machine translation. In P...

Ngày tải lên: 07/03/2014, 22:20

... organisms as diverse as Neurospora crassa, Candida tropicalis, Dictyostelium discoideum, Medicago varia (alfalfa), Arabidopsis t haliana, Oryza sativa (rice), Caenorhabditis elegans, Drosophila m elanogaster, ... from a single ancestral B subunit. In summary, in this study we have de®ned t wo separate PP 2A b inding domains in the regulatory a nd targeting B 5 6a subunit, which a...

Ngày tải lên: 08/03/2014, 10:20

... combine the manual scores of the pooled summaries? Kazawa et al. calculated the score of a summary as a weighted linear sum of the manual scores. Applying regression analysis (Yasuda et al., ... accurately as manual methods. In this paper, we investigate an automatic method that can reduce the errors of traditional automatic methods by using several evaluation results obtained m...

Ngày tải lên: 17/03/2014, 04:20

... production parameters are also sen- sitive to thinning strength. ECOTYPES AND CLINAL VARIATION OF OAK IN THE REMAINING TRIALS Some other traits have been observed in the other ... clinal variation and several ecotypes may exhibit consid- erable variation. Such factors should be taken into consideration in choosing oak provenances, whether the goal...

Ngày tải lên: 08/08/2014, 19:21