báo cáo khoa học: " Diffuse large B-cell non Hodgkin’s lymph

báo cáo khoa học: " Diffuse large B-cell non Hodgkin’s lymphoma in a 65-year-old woman presenting with hypopituitarism and recovering after chemotherapy: a case report" pptx

... this article as: Kenchaiah and Hyer: Diffuse large B-cell non Hodgkin’s lymphoma in a 65-year-old woman presenting with hypopituitarism and recovering after chemotherapy: a case report. Journal ... 5:498 http://www.jmedicalcasereports.com/content/5/1/498 Page 3 of 4 CASE REP O R T Open Access Diffuse large B-cell non Hodgkin’s lymphoma in...

Ngày tải lên : 10/08/2014, 23:20

4
272
0

báo cáo khoa học: "Synchronous perforation of non-Hodgkin’s lymphoma of the small intestine and colon: a case report" ppsx

... colon. Treatment generally inc ludes surgery, radiation, ther- apy, and chemotherapy. In the treatment of high-grade intestinal T cell non- Hodgkin’ s lymphoma or anaplastic large cell type lymphoma, a ... factors include advanced age, late stage disease, and a poor performance status, as well as delay and contraindication of chemotherapy. The prognosis of synchronous primar...

Ngày tải lên : 11/08/2014, 00:22

5
305
0

Báo cáo khoa học: " Acupuncture treatment for idiopathic Horner''''s syndrome in a dog" doc

... enophthalmos, and prolapsed nictitans for 2 days following sudden onset. According to history taking, ophthalmic, neurological, and radiological examination, the patient was diagnosed with idiopathic ... was alert during the examination. Other signs were not found after neurological and otoscopic examination, and complete blood counts, serum protein, and urine analysis w...

Ngày tải lên : 07/08/2014, 20:23

3
387
0

Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf

... advantage of the information that a semantic head provides. For example, a head usually provides information about the remaining daughters that the parser must find, and (since the head daughter ... descriptions includes Bach's (1979) wrapping operations, Pollard's (1984) head-wrapping operations, and Moortgat's (1996) extraction and infixation operations i...

Ngày tải lên : 20/02/2014, 18:20

7
397
0

báo cáo khoa học: " Urethral metastasis from non-seminomatous germ cell tumor: a case report" pptx

... liver and renal biochemistry was normal. A urethral catheter was placed, and drained normal urine. He underwent a radical left inguinal orchidectomy five days later. Histology indicated a non- seminomatous germ ... lie in the lymphatic drainage pathway of the testis. Case presentation A 35-year-old Caucasian man presented to his local gen- eral hospital emergency department...

Ngày tải lên : 11/08/2014, 03:20

4
350
0

Báo cáo khoa hoc:" Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case report" ppsx

... citation purposes) Journal of Medical Case Reports Open Access Case report Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case ... lung carcinomas was 6.7%. Only 3 of these 1090 cases were associated with DIPNECH and the primary tumors were carcinoids in all of these cases [4]. We have recently reported a...

Ngày tải lên : 11/08/2014, 10:23

3
356
0

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING ﬁnger protein Unkempt doc

... 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar- boxylase mRNA levels, detected by RT-PCR with speciﬁc primers 5¢GTCAGCCGCATCTTCTTTTG and ... Reck-Peterson SL & Crabtree GR (2002) Nuclear actin and actin-related proteins in chromatin remodeling. Annu Rev Biochem 71, 755–781. 3 de la Serna IL, Ohkawa Y & Imbalzano AN...

Ngày tải lên : 06/03/2014, 09:22

12
432
0

Báo cáo khoa học: The role of the Fe-S cluster in the sensory domain of nitrogenase transcriptional activator VnfA from Azotobacter vinelandii potx

... (underlined): 5¢ -CAAAA GGTCTCGAATGTCCAGC CTCCCCCAATA-3¢ and 5¢-CAAAA GGTCTCAGCGCTG CGGTAGTCCTTGTAGTTGA-3¢. After digestion with BsaI, the PCR product was ligated into the BsaI site of pASK-IBA3 plus . ... were determined using the BCA method (Bicinchoninic Acid Pro- tein Assay Kit, Sigma, Saint Louis, MO, USA) with BSA as a quantitative standard. After the ﬁnal puriﬁcation step,...

Ngày tải lên : 15/03/2014, 09:20

16
522
0

Báo cáo khoa học: Acute intermittent porphyria – impact of mutations found in the hydroxymethylbilane synthase gene on biochemical and enzymatic protein properties pdf

... as the standard and 12.5% TCA as a blank. The exact concentration was determined at room temperature by mea- suring A 405 and calculated as A 405 ⁄ e (e – 505 · 10 3 LÆcm )1 Æ mol )1 ). A standard ... GST tag and 42 kDa after GST cleavage). The p.Ala226ProfsX28 mutant protein was approximately 53 kDa before cleavage and strongly degraded after thrombin digest. HMBS enzymat...

Ngày tải lên : 23/03/2014, 04:21

10
587
0

Báo cáo khoa học: N-Glycans of the porcine nematode parasite Ascaris suum are modiﬁed with phosphorylcholine and core fucose residues pot

... GalNAcb1– 4GlcNAcb1–2Mana1–6(GalNAcb1–4GlcNAcb1–2Mana1–3)Manb1–4GlcNAcb1–4GlcNAc-Asn; GalGal, Galb1–4GlcNAcb1–2Mana1–6(Galb1– 4GlcNAcb1–2Mana1–3)Manb1–4GlcNAcb1–4GlcNAc-Asn; GnGn, GlcNAcb1–2Mana1–6(GlcNAcb1–2Mana1–3)Manb1–4GlcNAcb1–4GlcNAc- Asn; MM, Mana1–6(Mana1–3)Manb1–4GlcNAcb1–4GlcNAc-Asn; ... PC-containing N-glycans in the C. elegans mannosidase II mutant [22]. Some PC-containing gly...

Ngày tải lên : 23/03/2014, 09:21

13
506
0