báo cáo khoa học: "A challenging case of gastric outlet obstruction (Bouveret''''''''s syndrome): a case report" docx

... normal levels of alanine transaminase (ALT), aspartate aminotransfe r- ase (AST) and total bilirubin. A CT scan of h er abdomen and pelvis with c ontrast (Figure 1) showed pneumobilia with a choledochoduo- denal ... high morbidity and mortality rates. With the availability of computed tomography (CT) scans, earlier diagnosis and better management of these cases are possible. Our p...

Ngày tải lên: 10/08/2014, 23:20

... Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report An unusual cause of gastric outlet obstruction during percutaneous endogastric ... feeding: a case report Abdulzahra Hussain*, Hind Mahmood, Tarun Singhal and Shamsi El-Hasani Address: General Surgery Department, Princess Royal University Hospital, Kent, UK...

Ngày tải lên: 11/08/2014, 21:22

... Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser 1 , Martin Koskas 1 , Francine Walker 2 , Dominique Luton 1 and Chadi Yazbeck 1,3* ... it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Diagnosis and management of an immature teratoma during ovarian stimu...

Ngày tải lên: 10/08/2014, 22:20

... carcinoma. Preliminary studies have shown an anti-tumor activity of sorafenib in a variety of tumor types such as renal cell carcinoma, melanoma, thyroid cancer, ovarian cancer, sarcoma, and pancreatic ... speculate that a subset of patients capable of attaining a complete remis- sion will be identified as more patients with advanced metastatic HCC undergo therapy with sorafenib...

Ngày tải lên: 10/08/2014, 22:20

... consent was obtained from the patient at adult age for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Acknowledgements The ... equally prevalent in ma les and females while SLE has a 1:9 male to female ratio, which also argues against a shared pathogenesis. This includes...

Ngày tải lên: 10/08/2014, 23:20

... was smaller than that of the average adult (Table 1 and 2). Orthopantomogram or the Intra oral periapical radigraph could not be taken because the patient was not able to afford. The simultaneous ... 7:19 http://www.head-face-med.com/content/7/1/19 Page 8 of 10 CASE REP O R T Open Access Non-syndromic occurrence of true generalized microdontia with mandibular mesiodens - a rare cas...

Ngày tải lên: 11/08/2014, 20:21

... Characterization of a family of glycoproteins associated with the bile canalicu- lar membrane of normal hepatocytes but not expressed by two transplantable rat hepatocellular carcinomas. Cancer Res ... proteolysis and MALDI-TOF analysis. Data were analysed using MASCOT; accession numbers for each scored protein in the NCBI nonredundant databank are listed; Sequence coverage indicates...

Ngày tải lên: 19/02/2014, 07:20

... phosphory- lated and then released from lamin A ⁄ C. This regula- tion may take place following activation of kinases such as PKA in response to various signaling pathways. In addition, Aurora A kinase ... p38MAPK signaling modules & transcription factors. Proc Natl Acad Sci USA 99, 14189–14194. 12 Ito M, Yoshioka K, Akechi M, Yamashita S, Takama- tsu N, Sugiyama K, Hibi M, Nakabepp...

Ngày tải lên: 07/03/2014, 01:20

... Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA A CCATGGAGAATCAAGAGAAGGCGAGTATCGCGG G-3¢ and 5¢-GAGAG CTCGAGAACAGAACTTCAAGAC CGTGGCAGGAGC-3¢. The NcoI and Xho I sites used for further cloning are ... the steady-state kinetic parameters of MAO A- catalysed oxidation of benzyl- amine at 20 °C. Fig. S2. pH dependence of the reductive half-reaction of MAO A- catalysed oxid...

Ngày tải lên: 07/03/2014, 06:20

... is composed of 7 parallel b strands associated to an anti- parallel strand (b2) and is surrounded by 5 helices (a1 , a2 , a3 , a7 anda8). T he second domain c onsists of helices a4 , a5 and a6 a ll clustered ... and a c harge r elaying aspartic (or glutamic) acid. To further investigate the biochemical characterization of the enzyme, we have titrated these key residues that f...

Ngày tải lên: 07/03/2014, 16:20