báo cáo khoa học: "Discordant lymphoma consisting of splenic mantle cell lymphoma and marginal zone lymphoma involving the bone marrow and peripheral blood: a case report" potx
báo cáo khoa học: "Discordant lymphoma consisting of splenic mantle cell lymphoma and marginal zone lymphoma involving the bone marrow and peripheral blood: a case report" potx
... occurrence of splenic mantle cell lymphoma and marginal zone lymphoma involving the bone marrow and peripheral blood. Case presentation: We report the case of a 60-year-old asymptomatic Caucasian woman ... this article as: Carulli et al.: Discordant lymphoma consisting of splenic mantle cell lymphoma and marginal zone lymphoma inv...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: "An unusual presentation of precursor T cell lymphoblastic leukemia/lymphoma with cholestatic jaundice: case report" pot
... suggestive of intrahe- patic cholestasis. The significantly elevated serum CA 19- 9 level was later attributed to the cholestatic jaundice rather than primary hepatobiliary and pancreatic malig- nancies ... presentation of precursor T cell lymphoblastic leukemia /lymphoma with cholestatic jaundice: case report Kevin J Patel* 1 , Sahibzada U Latif 1 and Wanderley M de Calaca...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx
... generally found in the ovary and adrenal gland. In fishes, the adrenal homolog is not as compact as the adrenal gland found in mammals. In fishes, adrenal tissue exists as aminergic chromaffin and ... Mississauga, Canada), the zebra- fish fabp6 transcripts were amplified by PCR from total RNA extracted from various tissues using the forward pri- mer, 5¢-TAGGCAAAGAGAGCCACATGGAGA-3¢,...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC 6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGC C3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K ... (5¢fi3¢) MA(9) ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: X-ray structure of glucose/galactose receptor from Salmonella typhimurium in complex with the physiological ligand, (2R)-glyceryl-b-D-galactopyranoside pdf
... thiocyanate ion is also located in the asymmetric unit, based on the characteristic linear shape of the electron density, and the presence of 0.2 m NaSCN in the crystallization Table 1. Data collection ... forms are common in both plants and animals. Interestingly, GGal is also a good substrate for all three components of the lac operon, i.e. b-galacto- sidase, the l...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: " 3-D reconstruction of anterior mantle-field techniques in Hodgkin''''s disease survivors: doses to cardiac structures" pptx
... have addressed the prevalence of valvular disease, myocardial changes, coronary artery disease and the resulting risk of myocardial infarction or death from cardiac disease after thoracic radiotherapy, ... data sets of test patients. The information thus obtained will form the basis of a detailed analysis of patterns of cardiac damage within an interdisciplinary projec...
Ngày tải lên: 09/08/2014, 10:20
báo cáo khoa học: " A rare occurrence of a steroid cell tumor of the pelvic mesentery: a case report" pot
... differential diagnosis of steroid cell tumors. We ruled out the diagnosis of adrenocortical carcinoma and paraganglioma on the basis of immunohistochemical mar- kers. Adrenocortical carcinomas are negative ... The mass was excised. The patient came to our institute for further manage- ment. Her ECOG performance status was grade-1 and she had no supraclavicular lymphadenopa...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: " A qualitative exploration of prescription opioid injection among street-based drug users in Toronto: behaviours, preferences and drug availability" pdf
... these drugs are obtained and administered, and their availability and appeal among a small sample of street-based IDUs. Methods Between March and June 2007, 25 PO injectors who had injected at ... co-users of cocaine and crack among Canadian illicit opioid users. Sucht 2005, 51(4):217-24. 5. Health Canada: Reducing the harm associated with injection drug use in Canada. Ottaw...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo khoa học: "In vitro dynamics of HIV-1 BF intersubtype recombinants genomic regions involved in the regulation of gene expression" pdf
... GGT AGA AAA GGC CAA TG-3', LTR-Gag rev 5'-CTT GAT CCA GGC CTT CTA G-3', Vpr-Tat B fw 5'-TA GGA CAA CAT ATC TAT GAA ACT-3', Vpr-Tat B rev 5'-AA AAG CCT TAG GCA TCT CCT ATG-3', ... based on parental B and F subtype sequences: LTR-Gag B fw 5'-GCA AGT AGA AGA GGC CAA TA-3', LTR-Gag B rev 5'-GTT AAT CCT GGC CTT TTA G-3', LTR-Gag F fw 5'...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " In vitro dynamics of HIV-1 BF intersubtype recombinants genomic regions involved in the regulation of gene expression" docx
... GGT AGA AAA GGC CAA TG-3', LTR-Gag rev 5'-CTT GAT CCA GGC CTT CTA G-3', Vpr-Tat B fw 5'-TA GGA CAA CAT ATC TAT GAA ACT-3', Vpr-Tat B rev 5'-AA AAG CCT TAG GCA TCT CCT ATG-3', ... based on parental B and F subtype sequences: LTR-Gag B fw 5'-GCA AGT AGA AGA GGC CAA TA-3', LTR-Gag B rev 5'-GTT AAT CCT GGC CTT TTA G-3', LTR-Gag F fw 5'...
Ngày tải lên: 12/08/2014, 04:22