báo cáo khoa học: "Heterotopic ossification after patellar tendon repair in a man with trisomy 8 mosaicism: a case report and literature review" pptx
... a man with trisomy 8 mosaicism: a case report and literature review. Journal of Medical Case Reports 2011 5:453. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient ... 5:453 http://www.jmedicalcasereports.com/content/5/1/453 Page 4 of 4 unable to actively perform a straight leg raise. On pal- pation, there was generalize d tende...
Ngày tải lên: 10/08/2014, 23:20
... images in all patients demonstrated interstitial edema appearing as septa of high signal intensity in the subcutaneous fat, in the intermus- cular fascia, and in the vastus lateralis and vastus ... of the intermuscular fascia and septa, with the muscles again having a 'lacy pattern,' even at the innermost part of the vastus medialis (Figure 2b,c). Intra-articular f...
Ngày tải lên: 13/08/2014, 03:20
... contributed in patient accrual. All authors read and approved the final manuscript. Competing interests The authors declare that they have no competing interests. Table 5 Univariate and Multivariate Analyses ... to Pettavel and Morgenthaler staging [12]. Stage I was defined as a solitary or small metastasis, stage II was defined as two or three metas- tases with a maximum diamet...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Heterotopic ossification – a long-term consequence of prolonged immobility" pdf
... 2003, 3 48: 683 -693. 6. Sugita A, Hashimoto J, Maeda A, Kobayashi J, Hirao M, Masuhara K, Yoneda M, Yoshikawa H: Heterotopic ossification in bilat- eral knee and hip joints after long-term sedation. ... avoiding or halting the disease in critical care patients. This leads us to ask whether early diagnosis by MRI scanning is actually of any benefit. MRI scanning of the critically...
Ngày tải lên: 13/08/2014, 03:20
báo cáo khoa học: "Retrosternal abscess after trigger point injections in a pregnant woman: a case report" ppsx
... CAS E REP O R T Open Access Retrosternal abscess after trigger point injections in a pregnant woman: a case report Faisal Usman * , Abubakr Bajwa, Adil Shujaat and James Cury Abstract Introduction: ... this case report, acquired and interpreted data and drafted the manuscript. AB acquired and interpreted data and critically revised the manuscript for important intell...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: " Condylar growth after non-surgical advancement in adult subject: a case report" pptx
... several sources. Case report: A case of altered condylar morphology in adult male with temporomandibular disorders was reported in 30-year-old male patient. Erosion and flattening of the left mandibular condyle ... presentation A 30 year old male was referred to our department with a 4 years history of pain (pain scale VAS 80 ) and crepitus in the left TMJ during mas...
Ngày tải lên: 11/08/2014, 20:20
Báo cáo khoa học: Thioredoxin reductase from the malaria mosquito Anopheles gambiae Comparisons with the orthologous enzymes of Plasmodium falciparum and the human host pdf
... forward, 5¢-CGCAG GATCCGCGCCATTGAATCAGGAAAACTATGAGT ACGATCTGGTG-3¢ (containing a BamHI restriction site); and reverse, 5¢-TCCTAAGCTTCTAGCTGCAG CAGGTCGCCGGCGTCG-3¢ (containing a HindIII restriction ... co-migrating with the 58 kDa band. Sequence analysis by Edman degradation and mass spectral analysis Edman degradation of the 58 kDa band resulted in the N-terminal sequence of 17...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: "Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case-report" pdf
... Vasilios G Masdrakis 1 , Konstantinos A Kontoangelos 1 , Konstantinos Makrilakis 2 , Nikolaos A Karakatsanis 1 , Charalambos Papageorgiou 1 , Nikolaos Katsilambros 2 and Constantin R Soldatos 1 Address: ... comprising insulin (NPH) twice daily and rapid-acting regular insulin three times daily pre-prandially, followed by a regimen of NPH and very-rapid acting insulin analogue...
Ngày tải lên: 08/08/2014, 23:20
Báo cáo khoa học: "Mixed germ cell tumor metastatic to the skin: Case report and literature review" pptx
... Karaduman A, Bukulmez G, Sahin S, Ozkaya O, Erkan I: Renal cell carcinoma with skin metastasis. J Eur Acad Dermatol Venereol 2004, 18: 386 -7. 8. Saeed S, Keehn CA, Morgan MB: Cutaneous metatasis: ... the prostate [5], bladder [6], and kidney [7]. This report describes a case of testicular germ cell tumor with skin metastases at the initial presentation. Case Presentation A...
Ngày tải lên: 09/08/2014, 03:21
báo cáo khoa học: "Intracranial hypotension secondary to spinal arachnoid cyst rupture presenting with acute severe headache: a case report" ppsx
... cerebrospinal fluid examination and a magnetic resonance angiogram were normal. The headache persisted and magnetic resonance imaging revealed bilateral thin subdural collections, a spinal subarachnoid ... UK. 2 Department of Radiology, Lilavati Hospital and Research Centre, Mumbai, India. 3 The Headache and Migraine Clinic, Lilavati Hospital and Research Centre, Mumbai, India....
Ngày tải lên: 11/08/2014, 02:22