báo cáo khoa học: " A case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case report" docx

báo cáo khoa học: " A case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case report" docx

báo cáo khoa học: " A case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case report" docx

... JOURNAL OF MEDICAL CASE REPORTS A case of polyarteritis nodosa limited to the right calf muscles, fascia, and skin: a case report Ahmed et al. Ahmed et al. Journal of Medical Case Reports ... 5:450 http://www.jmedicalcasereports.com/content/5/1/450 (12 September 2011) CAS E REP O R T Open Access A case of polyarteritis nodosa limited to t...

Ngày tải lên: 10/08/2014, 23:20

5 291 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

... TGTTGCTGTTAAACTGAAC CGCGCATTTCTCACCTACTAAC Phe554 fi Ala forward GAGAAATCGTGGGTTCAG GCCAACAGCAACAGCCAGCTC Phe554 fi Ala reverse GAGCTGGCTGTT GCTGTTGGCCTGAACCCACGATTTCTC Asn555 fi Ala forward TCGTGGGTTCAG TTTAACAGCAACAGCCAGCTC Asn555 ... 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢ (Trp551 fi Ala), 5¢-GTTGCTGTTAGCCTGAACCCAC GAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAA CCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTG...

Ngày tải lên: 16/03/2014, 12:20

15 337 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

... modeled. Table S4. Average rmsd (A ˚ ) for the conserved catalytic residues calculated from MD simulations of a- CT and the various Lac -a- CT conjugates modeled. This material is available as part of the ... mechanism of the enzyme. Structural insights into the mechanochemical nature of a- CT catalysis A more detailed analysis of the influence of chemical glycos...

Ngày tải lên: 19/02/2014, 05:20

17 531 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... 2002 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1). This means that Trp169 does not play a role as ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad. ACK...

Ngày tải lên: 21/02/2014, 03:20

7 603 0
Báo cáo khoa học: Secondary structure of lipidated Ras bound to a lipid bilayer pptx

Báo cáo khoa học: Secondary structure of lipidated Ras bound to a lipid bilayer pptx

... of Ras at the air–water interface was analysed. With the largely increased signal -to- noise ratio of ATR-FTIR, we have, for the Table 1. X-Ray and NMR-based secondary structure of Ras in comparison ... dithiothrei- tol and 0.1 mm GDP at pD 7.8. Protein adsorption on to the membrane was followed by the evolution of the amide I and II (amide I¢ and II¢ in the c...

Ngày tải lên: 07/03/2014, 04:20

9 484 0
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

... parasitic protozoa such as Trichomonas vaginalis [12] and Entamoeba histolytica [13], and the plant Arabidopsis thaliana [14]. MGL has been implicated in the degradation of toxic SAAs [15], and ... Parasitol 147, 163–176. 36 Sato D, Yamagata W, Kamei K, Nozaki T & Harada S (2006) Expression, purification and crystallization of L-methionine gamma-lyase 2 from Entamoeba histo...

Ngày tải lên: 07/03/2014, 05:20

13 406 0
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

... stop TCTfiCCT + CAAfiTAA Between the N-terminal regulatory domain and TMD1 K250E AAAfiGAA Between the N-terminal regulatory domain and TMD1 G348D GGTfiGAT Loop B G348R GGTfiCGT Loop B G348S GGTfiAGT ... is an atypical aquaglyceroporin as the highly conserved NPA motifs in the B- and the E-loop are NPS (Asn-Pro-Ser) and NLA (Asn-Leu-Ala), respectively, sequences that are also found...

Ngày tải lên: 07/03/2014, 15:20

9 383 0
Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf

Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf

... Linguistics Automatic Part -of- Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario Sandipan Dandapat, Sudeshna Sarkar, Anupam Basu Department of Computer ... described here are very simple and efficient for automatic tagging even when the amount of available annotated text is small. The models have a much higher accura...

Ngày tải lên: 31/03/2014, 01:20

4 455 0
báo cáo khoa học: " Retailers’ knowledge of tobacco harm reduction following the introduction of a new brand of smokeless tobacco" pps

báo cáo khoa học: " Retailers’ knowledge of tobacco harm reduction following the introduction of a new brand of smokeless tobacco" pps

... Canada because of the near prohibition on the manufacturers’ ability to communicate health information to their customers other than in-person at the point of sale, and restric- tions on the right ... briefings and written materials about dMS.Inaddition,wetookadvantageofthestudyto also examine compliance with recommendations regard- ing the sale of tobacco t o young...

Ngày tải lên: 11/08/2014, 18:20

7 314 0
Từ khóa:
w