báo cáo khoa học: "Aggregatibacter aphrophilus in a patient with recurrent empyema: a case report " ppsx

... 11):ii18-ii28. doi:10.1186/1752-1947-5-448 Cite this article as: Ratnayake et al.: Aggregatibacter aphrophilus in a patient with recurrent empyema: a case report. Journal of Medical Case Reports 2011 5:448. Submit your next manuscript ... pneumonia. A wide bore chest drain was inserted and a sample of pus was inocu- lated into aerobic and anaerobic blood culture bottl...

Ngày tải lên: 10/08/2014, 23:20

... B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal carcinoma in children: comparison of conventional and intensity- modulated ... Freeman C: Standard and nonstandard craniospinal radiotherapy using helical TomoTherapy. Int J Radiat Oncol Biol Phys 2010, 77:926-31. 12. Penagaricano JA, Yan Y, Corry P, Moros E,...

Ngày tải lên: 09/08/2014, 09:21

... puberty in a boy with HcG-producing hepatoma. Case report. Helv Paediatr Acta 1980, 35(2):155-163. 11. Morinaga S, Yamaguchi M, Watanabe I, Kasai M, Ojima M, Sasano N: An immunohistochemical study ... 5:422 http://www.jmedicalcasereports.com/content/5/1/422 Page 2 of 4 CASE REP O R T Open Access Precocious puberty in an infant with hepatoblastoma: a case report Usama Al-J...

Ngày tải lên: 10/08/2014, 23:20

... compare and contrast qualitative and quanti- tative data about the same phenomenon; emphasizing how qualitative findings link to and confirm quantitative findings, as well as how quantitative findings ... Canada, 3 Faculty of Nursing, University of Manitoba, Winnipeg, Manitoba, Canada, 4 Canadian Centre for Health and Safety in Agriculture (CCHSA), University of Saskatchewan, Saskatoon,...

Ngày tải lên: 11/08/2014, 16:20

... eligibility. Patients with a pre-existing indication for the use of rHuEPO, including anemia associated with end-stage renal disease, cancer, or cancer therapy, and those with HIV infection treated with ... demonstrated a blunted EPO response in critically ill pediatric patients with acute ane- mia and acute hypoxia. Enrolled patients included 21 with acute anemia, 18 with...

Ngày tải lên: 12/08/2014, 22:21

... Kruse JA, Thill-Baharozian MC, Carlson RW: Comparison of clin- ical assessment with APACHE II for predicting mortality risk in patients admitted to a medical intensive care unit. JAMA 1988, 260:1739-1742. 10. ... Zimmerman JE, Kramer AA, McNair DS, Malila FM: Acute Physi- ology and Chronic Health Evaluation (APACHE) IV: hospital mortality assessment for today’s critically ill patients....

Ngày tải lên: 13/08/2014, 03:20

... texts with partial parsing A. Ferr~indez; M. Palomar Dept. Languages and Information Systems Alicante University - Apt. 99 03080 - Alicante - Spain antonio@dlsi.ua.es mpalomar@dlsi.ua.es ... lexical reiteration, ). We will work in a similar way to this approach, since we use some of its antecedent indicators, but we automatically apply a partial parsing that allows us to deal...

Ngày tải lên: 08/03/2014, 05:21

Ngày tải lên: 09/03/2014, 01:20

... 5¢-TA ATACGACTCACTATAGGGCGAATAGGCGGGAATT TTGCATC-3¢ containing the T7 polymerase promoter sequence, and TMV4 (downstream) 5¢-CAATACTGT CTTTCTGGCCTTC-3¢. TMV RNA was transcribed in vitro using ... genome within the replicase-coding sequence (ORF 1) was an additional advantage. The designed catalytic strand of the leadzyme was a 16-nucleotide RNA (5¢-ACAUAUGGAGUCCCUU-3¢), and its binding to...

Ngày tải lên: 16/03/2014, 12:20

... training and 10% testing sets for 5-cross validation. MOCHA and TORGO data are never combined in a single training set due to dif- fering EMA recording rates. In all cases, models are database-dependent ... ms in the TORGO database, and 32 ms in MOCHA. Phoneme boundaries are de- termined automatically in the MOCHA database by forced alignment, and by a speech-language pathologis...

Ngày tải lên: 16/03/2014, 23:20