báo cáo khoa học: "Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases" pps

báo cáo khoa học: "Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases" pps

báo cáo khoa học: "Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases" pps

... Access Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases Joana Gomes * , Ana Antunes, Aurora Carvalho and Raquel Duarte Abstract Introduction: Esophageal involvement ... growth as esophageal polyps may also be present as in case two [5,11]. Esophageal carcinoma is part of the differential diagnosis as was the case for both our p...

Ngày tải lên: 10/08/2014, 23:20

5 355 0
Báo cáo khoa học: "Spontaneous regression in alveolar soft part sarcoma: case report and literature review" pps

Báo cáo khoa học: "Spontaneous regression in alveolar soft part sarcoma: case report and literature review" pps

... Mohammed N BaniHani* - mohbanihani@hotmail.com; Abdel Rahman A Al Manasra - abdjust@yahoo.com * Corresponding author Abstract Background: Sarcomas are a type of malignant tumors that arise from ... had a leg pri- mary tumor more than 15 years ago and multiple lung and brain metastases. She also was found to have caecal metastases, revealed by an anemia, she was treated by laparoscopi...

Ngày tải lên: 09/08/2014, 04:21

4 321 0
Báo cáo khoa hoc:" Seizures as the first manifestation of chromosome 22q11.2 deletion syndrome in a 40-year old man: a case report" doc

Báo cáo khoa hoc:" Seizures as the first manifestation of chromosome 22q11.2 deletion syndrome in a 40-year old man: a case report" doc

... syndrome can have a variety of brain abnormalities when assessed by neuroimaging. Basal ganglia calcification, similar to that seen in the patient presented in this case report, have been rarely ... Medical Case Reports Open Access Case report Seizures as the first manifestation of chromosome 22q11.2 deletion syndrome in a 40-year old man: a case report Adriano R Tonelli*...

Ngày tải lên: 11/08/2014, 10:22

5 254 0
Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf

Tài liệu Báo cáo khoa học: "Lemmatisation as a Tagging Task" pdf

... Linguistics Lemmatisation as a Tagging Task Andrea Gesmundo Department of Computer Science University of Geneva andrea.gesmundo@unige.ch Tanja Samard ˇ zi ´ c Department of Linguistics University of Geneva tanja.samardzic@unige.ch Abstract We ... Geneva tanja.samardzic@unige.ch Abstract We present a novel approach to the task of word lemmatisation. We formalise lemmati- sation...

Ngày tải lên: 19/02/2014, 19:20

5 456 0
Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx

Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx

... sense of a word as its vari- able. Each agent w i is associated with the variable s w i . The value assigned to this variable indicates the sense assigned by the algorithm. 3.3 Domains Senses of a ... These approaches crucially rely on lexical knowledge base. Graph-based WSD approaches (Agirre and Soroa, 2009; Sinha and Mihalcea, 2007) per- form disambiguation over a graph compose...

Ngày tải lên: 20/02/2014, 04:20

6 369 0
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt

Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt

... with protparam (http://www.expasy.org). Removal of the His-tag A factor Xa cleavage site was created between the last amino acid (valine) and the His-tag. Cleavage by factor Xa occurs after an arginine, ... Listeria innocua. Biochem J 338, 71–75. 32 Havukainen H, Haataja S, Kauko A, Pulliainen AT, Salminen A, Haikarainen T, Finne J & Papageorgiou AC (2008) Structural basis of the...

Ngày tải lên: 15/03/2014, 09:20

15 293 0
Báo cáo khoa học: "DATR AS A LEXICAL COMPONENT FOR PATR" pot

Báo cáo khoa học: "DATR AS A LEXICAL COMPONENT FOR PATR" pot

... the global environ- ment is changed in the course of the evaluation. As a declarative language, DATR is independent of the procedural evaluation strate- gies embodied in particular DATR-implementa- ... regularities using default inheritance, and exceptions, overriding. DATR axioms consist of node-path pairs associated with a right-hand side. This can be a value (atomic or...

Ngày tải lên: 18/03/2014, 02:20

6 388 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... plasmid pBDC [34] (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, ... [18]. GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains (Fig. 2). Active v-src expr...

Ngày tải lên: 23/03/2014, 07:20

11 427 0
Báo cáo khoa học: "Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case-report" pdf

Báo cáo khoa học: "Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case-report" pdf

... salts was relatively contra-indicated as an anti-manic agent and clearly contra-indicated as a long-term mood stabilizer because of their well known nephrotoxicity and our patient's already ... report Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case -report Panagiotis Oulis* 1 , Evangelos Karapoulios 1 , Anastasio...

Ngày tải lên: 08/08/2014, 23:20

4 308 0
báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

... the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, whereas the labia ... complications of this presentation are infections of the urinary tract and retention of urine in the vagina. We present the case of a post-menopausal woman with adnexal mas...

Ngày tải lên: 10/08/2014, 22:20

14 367 0
w