báo cáo khoa học: "Meniscoplasty for stable osteochondritis dissecans of the lateral femoral condyle combined with a discoid lateral meniscus: a case report" ppt
báo cáo khoa học: "Meniscoplasty for stable osteochondritis dissecans of the lateral femoral condyle combined with a discoid lateral meniscus: a case report" ppt
... the damaged discoid lateral meniscus is
considered to be one of the main causes of OCD of the
lateral femoral condyle. Matsumoto et al. [10] reported
a case with bilateral OCD lesions of the lateral ... Lim and Bae: Meniscoplasty for stable
osteochondritis dissecans of the lateral femoral condyle combined with
a discoid lateral men...
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... formation
of the M
3
b cluster, demonstrating that the individual
binding constants of divalent metal ions for the
a domain are larger than those for the b domain.
Further interpretation of these ... metallation of
the two-domain protein by Co
2+
indicated a simulta-
neous metallation of the a and b domains, with two
metal ions populating the a domain, an...
Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt
... become a major priority on
the agendas of the World Health Organization and of national ministries
of health and military organizations. An alternative to vaccines is found in
therapeutic-based approaches. ... endoproteases of the Flavivi-
rus genus [97,98]. The presence of a small activating
cofactor protein is a prerequisite for the optimal cata-
lytic activity...
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... ggggccgcaacgagcgcctgtggcgg Leu25 to Ala
P2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to Ala
L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala
2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg ... to Ala
F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala
3K > Q K37Q F ggtgcgtcgatccaaggctttcaacaagcaatgag Lys37, Lys40 and Lys41 to Gln
TatB mutants
E8Q E8Q...
Tài liệu Báo cáo khoa học: "NLP for Indexing and Retrieval of Captioned Photographs" pot
... its meaning is retained in an elegant and
simple way. The relational facts that are extracted
are of the form: ARG1-RELATION-ARG2 and
they are used as indexing terms for the crime scene
visual records. ...
where
Head
is
the head of the noun phase and
Adj
and
Qual
are
adjectives and nominal qualifiers syntactically at-
tached to the head. For example, the noun phra...
Báo cáo khoa học: In vitro embryonic developmental phosphorylation of the cellular nucleic acid binding protein by cAMP-dependent protein kinase, and its relevance for biochemical activities pdf
... promotes the annealing of the CT and
Comp-CT sequences, an activity that may indicate the
ability of CNBP to remodel nucleic acid conformation.
Alteration of the CT element conformation might
either ... Yasuda J, Mashiyama S, Makino R, Ohyama S, Sekiya
T & Hayashi K (1995) Cloning and characterization of
rat cellular nucleic acid binding protein (CNBP) cDNA.
DNA Res 2, 45–...
Báo cáo khoa học: "Atestbed for research in origins of language" doc
... experiments that can make use of a similar
representation.
The approach taken in Babel has been to sep-
arate out the task of data collection from the
task of data display. We call the data collectors ... the agent and the world classes. The
agent classes define the capabilities of individ-
ual agents - the way they store information,
the kind of utterance...
Báo cáo khoa học: "SemiHemizygosity for Atm and Brca1 influence the balance between cell transformation and apoptosis" ppt
... 100
comets of each sample were analyzed with a free soft-
ware called Casp [30].
Results
Cell Transformation Assay
Radiation-induced transformation of MEF was exam ined
as a surrogate for carcinogenesis ... [10].
InthecurrentstudyweusedanotherpairofDNA
repair genes - Atm and Brca1.Aswasthecaseinour
prior study, the background transformation frequency of
MEF was the same for...
Báo cáo khoa học: "Radiosurgery for pituitary adenomas: evaluation of its efficacy and safety" ppsx
... is an effective and safe therapeutic option in the management of selected patients with pituitary
adenomas. The short latency of the radiation response, the highly acceptable radiological and ... the
management of selected patients with pituitary adeno-
mas. The short latency of the radiation response, the
highly acceptable radiological and hormonal control and
abs...
Báo cáo khoa học: "Remifentanil for analgesia-based sedation in the intensive care unit" pdf
... need any propofol when remifentanil
was used as the primary agent.
This observation in favour of an analgesia-based sedation
regimen using remifentanil is in accordance with the results
of the ... Recov-
ery after remifentanil and sufentanil for analgesia and seda-
tion of mechanically ventilated patients after trauma or major
surgery. Br J Anaesth 2001, 86:763-768.
7. Kress J...
Từ khóa: