báo cáo khoa học: "Meniscoplasty for stable osteochondritis dissecans of the lateral femoral condyle combined with a discoid lateral meniscus: a case report" ppt

... the damaged discoid lateral meniscus is considered to be one of the main causes of OCD of the lateral femoral condyle. Matsumoto et al. [10] reported a case with bilateral OCD lesions of the lateral ... Lim and Bae: Meniscoplasty for stable osteochondritis dissecans of the lateral femoral condyle combined with a discoid lateral men...

Ngày tải lên: 10/08/2014, 23:20

... formation of the M 3 b cluster, demonstrating that the individual binding constants of divalent metal ions for the a domain are larger than those for the b domain. Further interpretation of these ... metallation of the two-domain protein by Co 2+ indicated a simulta- neous metallation of the a and b domains, with two metal ions populating the a domain, an...

Ngày tải lên: 19/02/2014, 00:20

... become a major priority on the agendas of the World Health Organization and of national ministries of health and military organizations. An alternative to vaccines is found in therapeutic-based approaches. ... endoproteases of the Flavivi- rus genus [97,98]. The presence of a small activating cofactor protein is a prerequisite for the optimal cata- lytic activity...

Ngày tải lên: 19/02/2014, 00:20

... ggggccgcaacgagcgcctgtggcgg Leu25 to Ala P2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to Ala L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala 2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg ... to Ala F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala 3K > Q K37Q F ggtgcgtcgatccaaggctttcaacaagcaatgag Lys37, Lys40 and Lys41 to Gln TatB mutants E8Q E8Q...

Ngày tải lên: 19/02/2014, 17:20

... its meaning is retained in an elegant and simple way. The relational facts that are extracted are of the form: ARG1-RELATION-ARG2 and they are used as indexing terms for the crime scene visual records. ... where Head is the head of the noun phase and Adj and Qual are adjectives and nominal qualifiers syntactically at- tached to the head. For example, the noun phra...

Ngày tải lên: 22/02/2014, 02:20

... promotes the annealing of the CT and Comp-CT sequences, an activity that may indicate the ability of CNBP to remodel nucleic acid conformation. Alteration of the CT element conformation might either ... Yasuda J, Mashiyama S, Makino R, Ohyama S, Sekiya T & Hayashi K (1995) Cloning and characterization of rat cellular nucleic acid binding protein (CNBP) cDNA. DNA Res 2, 45–...

Ngày tải lên: 16/03/2014, 12:20

... experiments that can make use of a similar representation. The approach taken in Babel has been to sep- arate out the task of data collection from the task of data display. We call the data collectors ... the agent and the world classes. The agent classes define the capabilities of individ- ual agents - the way they store information, the kind of utterance...

Ngày tải lên: 23/03/2014, 19:20

... 100 comets of each sample were analyzed with a free soft- ware called Casp [30]. Results Cell Transformation Assay Radiation-induced transformation of MEF was exam ined as a surrogate for carcinogenesis ... [10]. InthecurrentstudyweusedanotherpairofDNA repair genes - Atm and Brca1.Aswasthecaseinour prior study, the background transformation frequency of MEF was the same for...

Ngày tải lên: 09/08/2014, 08:22

... is an effective and safe therapeutic option in the management of selected patients with pituitary adenomas. The short latency of the radiation response, the highly acceptable radiological and ... the management of selected patients with pituitary adeno- mas. The short latency of the radiation response, the highly acceptable radiological and hormonal control and abs...

Ngày tải lên: 09/08/2014, 09:20

... need any propofol when remifentanil was used as the primary agent. This observation in favour of an analgesia-based sedation regimen using remifentanil is in accordance with the results of the ... Recov- ery after remifentanil and sufentanil for analgesia and seda- tion of mechanically ventilated patients after trauma or major surgery. Br J Anaesth 2001, 86:763-768. 7. Kress J...

Ngày tải lên: 12/08/2014, 20:20