báo cáo khoa học: "Atypical presentations and rare metastatic sites of renal cell carcinoma: a review of case reports" pptx

... Open Access Atypical presentations and rare metastatic sites of renal cell carcinoma: a review of case reports Petros Sountoulides 1* , Linda Metaxa 2 and Luca Cindolo 3 Abstract Renal cell carcinoma ... appearance of metastatic disease in organs and sites that are considered outside of the “usual” metastatic pathway of RCC. Rare metastatic s...

Ngày tải lên: 10/08/2014, 23:20

... [70]. Additionally, radiation-induced damage of astrocytes further causes leakage of VEGF. This then acts on the capillary targets and causes neovascularization. The new vessels are leaky and ... F, Hansen J: Nasopharyngeal cancer in Greenland. Acta Pathologica Microbiologica Scandinavica Section A Pathology 1977, 85:850-858. 2. Perez CA, Brady LW: Principles and Practice of...

Ngày tải lên: 09/08/2014, 09:21

... Flowers ME, Aneja T, Smith KD, Meehan SM, Nicosia RF, Alpers CE: Spectrum of renal pathology in hematopoietic cell transplantation: a series of 20 patients and review of the literature. Clin J Am Soc ... Hesdorffer CS, Appel GB, D’Agati VD, Savage DG: Membranous glomerulopathy associated with graft-versus- host disease following allogeneic stem cell transplantation. Report...

Ngày tải lên: 11/08/2014, 02:21

... nucleotide product); 5¢-CTTCTGTCTTCACCATCTACA-3¢ and 5¢-AGTGGAGGTAAACTTCGGCAG-3¢ for h-geminin (710 nucleotide product) and 5¢-CACCTTCTACAATG AGCTGC-3¢ and 5 ¢-AGGCAGCTCGTAGCTCTTCT-3¢ for h-actin (437 nucleotide ... for assistance with experiments, M. Ohtsubo and N. Tsopanoglou for cell l ines, t he Ba stiaens laboratory f or help with quantitations and Profs G. Maniatis, C. Flord...

Ngày tải lên: 07/03/2014, 16:20

... stumps and lack of carbohydrate reserves (Blake and Raitanen, 1981; Ferm et al, 1986). However, Auclair and Bouvarel (199 2a) showed that hybrid poplar coppiced annual- ly ... on the INRA estate near Orléans (central France). Situated on a loamy, gravelly ancient terrace of the Loire river, the sandy acid soil has a very low water and...

Ngày tải lên: 08/08/2014, 23:22

... majority of pancreatic malignancies. Adenosquamous carcinoma (ASC) of the pancreas is an unusual variant of pancreatic neoplasm [1- 4], and is characteristic by histological patterns of both ductal adenocarcinoma ... manuscript. JYY: study design and analysis, surgical management of patients. CMF: study design and analysis, surgical management of patients. All authors read...

Ngày tải lên: 09/08/2014, 07:21

... (36.5°C) and his CRP was negative. Radiographic examination of his hip did not reveal any pathology and a diagnosis of TS was made. Bed rest and anti- inflammatory therapy with acetaminophen ... can be made, and this can easily mask a subtle musculoskeletal in jury. Case presentations: We report the cases of three Caucasian patients (two boys, aged 20-months- and three-...

Ngày tải lên: 10/08/2014, 23:22

... Herds A and E held dry cows in tie stalls and herds A, B and C held dry cows and heifers separate from lactating cows until after calving. Herd A and B had a sep- arate group for dry animals receiving ... (86.0%) displaced abomasum (DA), ketosis (K) and total disease incidence (Total) recorded Acta Veterinaria Scandinavica 2008, 50:31 http://www.actavetscand.com/content/50/...

Ngày tải lên: 12/08/2014, 18:22

... Medical Associates of McMaster University, Canada, and the Father Sean O'Sullivan Research Center of St. Joseph's Hospital in Hamilton. We thank Andrea Tkaczyk, Laura Donahoe, Jill Hancock ... Institutes of Health Research, DJC is a Research Chair of the Canadian Institutes for Health Research, MAC holds a Career Investigator Award from the Heart and Stroke Foun...

Ngày tải lên: 12/08/2014, 22:22

... TGTTCCTCCTCCAGTCAATACCC 58 Ck5 TTCTTTGATGCGGAGCTGTCCCAGA 60 Ck19 AGGTGGATTCCGCTCCGGGCA 61 p-cad2–3 TCAgggAggCTgAAgTgAC 59 p-cad5–8 GAGAGATTGGGTGGTTGCTC 60 p-cad8–10 CCAGGCCACAGACATGGAT 59 p-cad10–11 TCCAAAgTCgTTgAggTC ... Tamura I, Nakajima M, Morita S, Kakudo K, Shirasu R, Tanaka A & Sakaki T (1999) Correlation of E-cadherin and alpha-catenin expression with differentiation of or...

Ngày tải lên: 30/03/2014, 04:20