báo cáo khoa học: "Control of prostate cancer associated with withdrawal of a supplement containing folic acid, L-methyltetrahydrofolate and vitamin B12: a case report" pps

... CAS E REP O R T Open AccessControl of prostate cancer associated with withdrawal of a supplement containing folic acid, L-methyltetrahydrofolate and vitamin B12: a case reportGlenn Tisman* and ... Garcia: Control of prostate cancer associated with withdrawal of a supplement containing folic acid, L-methyltetrahydrofolate and vitamin B12: a case report. Journal of Medical Case Reports 2011 ... e of PSA failure in castrate-resistant/refractory prostate cancer. Our patient’s ingestion of large amounts of FA/folate and vitamin B12was associated with PSAacceleration, while withdrawal...

báo cáo khoa học: "Apple skin patterning is associated with differential expression of MYB10" ppsx

... AACCTTCACAAGGGTTGTCG TTCGTTGGATTCCGTTAAGC-1094 to -891 GGTCCCGCAAGACAGATAACC CACTAAAAAAACACTTAGGCATACGAA-991 to -776 GGCTGAACCACCTATGAAAATAATG AGACGCTACACCTAACACATTGCT-846 to -651 CTCTTGTGAAAGCTTAGTGAGTTGAAG ... GAAAAAGCAGCGAAAGCATGA GGAAATCAATCCCAGGGCATA-303 to -182 GTCGTGCAGAAATGTTAGCTTTTC CAGAAGCAAACACTGACAAGTTTAAAAC-168 to -45 TGCACGTCACTGGCCTTGTA TAAGCTTAGCTATTCTTTTGCCTGCTA-51 to 105 AGTGGGTAGCAGGCAAAAGA TCCACTTTCCCTCTCCATGA146 ... -1873 GAAATCGTTCGAAGGTCTAAGG ACAGCAAACACCCAAAATCC-1874 to -1681 GTTGCCATTTTTGAACACAACA CCACGTGTTCAGGGTCCTTT-1708 to -1426 TTTAATAAAAAGGACCCTGAACACG CGTGATATATGATCTTGATGGTTGA-1411 to -1229 AACCTTCACAAGGGTTGTCG...

Báo cáo khoa học: " Higher initial tidal volumes associated with the subsequent development of acute lung injury in dose-response relationship" docx

... Lee and colleagues [4], a prospective randomized and (ideally) multicentric trial of low tidal volume ventilation in patients without ALI is warranted. Such a trial should address the safe ... unmeasured factors that were also associated with poor outcome. Even so, the apparent dose-response relationship and the consistency of the findings with those of other animal and human studies are ... lower tidal volume limit and the role of PEEP in low tidal volume strategies. Until data from a well-designed trial are available, we cannot recommend universal application of this strategy....

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING ﬁnger protein Unkempt doc

... Ulbrich A, Matsuda A, ReddyVA, Orth A, Chanda SK, Batalov S & Joazeiro CA(2008) Genome-wide and functional annotation of human E3 ubiquitin ligases identiﬁes MULAN, a mitochondrial E3 that regulates ... largemultisubunit assemblies containing either Brm or Brg1as the catalytic ATPase subunit and a variable subset of approximately 10 Brg ⁄ Brm -associated factors(BAF). Among the later, the 60 kDa subunit BAF60 ... byRT-PCR (Access RT-PCR system; Promega, Madison, WI,USA) using Unkempt-speciﬁc primers 5¢TCTTCGAGTGCAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar-boxylase...

báo cáo khoa học: "Correction: Selective intraarterial radionuclide therapy with Yttrium-90 (Y-90) microspheres for unresectable primary and metastatic liver tumors." pptx

... Bilgic² ¹ Ankara University, Medical School, Department of Nuclear Medicine, Ankara, Turkey. ² Ankara University, Medical School, Department of Radiology, Ankara, Turkey. *Corresponding author: ... *Corresponding author: csoydal@yahoo.com Correction After the publication of this work [1], we became aware of the fact that there was date mistakes in the Abstract, Patients and method and Results sections. ... intraarterial radionuclide therapy with Yttrium-90 (Y-90) microspheres for unresectable primary and metastatic liver tumors. N. Ozlem Kucuk¹, Cigdem Soydal¹, Seda Lacin¹, Elgin Ozkan¹, Sadık...

báo cáo khoa học: "Changes in physiological tremor associated with an epileptic seizure: a case report" doc

... PT and not that our patient was swa ying theirright hand. As for the unchanged heart rate and respira-tion, this indicates a focal event, and not a generalizedchange in our patient’s state. ... fact, thereis only anecdotal mention of pre-ictal and ictal changes in clinically noticeable tremor in the literature. Case presentation: Our patient was a left-handed, 27-year-old Caucasian ... funded by a Natural Science and EngineeringResearch Council of Canada through a Master’s scholarship (BC),Undergraduate Student Research Award (MR) and operating grant (CD) aswell as a Fonds de...

Báo cáo khoa hoc:" Sporadic ALS is not associated with VAPB gene mutations in Southern Italy" ppt

... Magariello1, AnnaLia Gabriele1, Vincenzo Labella3, Isabella Laura Simone4, Giovanni Majorana5, Maria Rosaria Monsurrò2, Paola Valentino6, Maria Muglia1 and Aldo Quattrone*1,6Address: ... Alessandra Patitucci - a. patitucci@isn.cnr.it; Angela Magariello - a. magariello@isn.cnr.it; AnnaLia Gabriele - a. gabriele@isn.cnr.it; Vincenzo Labella - vlabella@unipa.it; Isabella Laura Simone - isasimone@neurol.uniba.it; ... isasimone@neurol.uniba.it; Giovanni Majorana - majov@tiscali.it; Maria Rosaria Monsurrò - mariarosaria.monsurro@unina2.it; Paola Valentino - p.valentino@isn.cnr.it; Maria Muglia - m.muglia@isn.cnr.it; Aldo Quattrone*...

Báo cáo y học: " Early lactate clearance is associated with biomarkers of inflammation, coagulation, apoptosis, organ dysfunction and mortality in severe sepsis and septic shock" docx

... os-ingDIC,wechosetomeasureD-Dimerasamarkerofcoagulation in this study as it is widely available, a cor-relate to the pro-inflammatory cytokine levels, and a valuable screening marker for organ failure and mortal-ity ... Figure 3 Kaplan-Meier 12-month survival analysis based on lactate clearance quartile. Lactate clearance quartile 1, 2, 3, and 4 have lactateclearance of -24.3 ± 42.3, 30.1 ± 7.5, 53.4 ± 6.6, and 75.1 ... medical and surgical ICU nurses and technicians; and theDepartments of Respiratory Therapy, Pathology, Medical Records, and Admitting and Discharge at Henry Ford Hospital for their patience and cooperation...

báo cáo khoa học:" Preferences for health outcomes associated with Group A Streptococcal disease and vaccination" pps

... design,analysis and interpretation of data, statistical analysis, and critical revision of the manuscript. CG participated in the acquisition of data, administrative,technical, and material support, ... conception and design, acquisition of data, analysis and interpretation of data, drafting of the manuscript, statistical analysis, and the obtaining of funding. JS participated in the conception and ... support, and critical revision of the manuscript. JHparticipated in the conception and design, analysis and interpretatio n of data, and critical revision of the manuscript. All authors read and approvedthe...

Báo cáo y học: " Glucocorticoid receptor gene polymorphisms associated with progression of lung disease in young patients with cystic fibrosis" doc

... was TATTCAGACTCAATCAAGG.For ER22/23EK (rs6189 and rs6190), the forward primerwas 5'-TCCAAAGAATCATTAACTCCTGGTAGA-3', and the reverse primer was 5'-GCTCCTCCTCTTAGGGTTT-TATAGAAG-3'. ... FAM) wasTCCAGATCCTTGGCACCTATTCCAATTTTCGGAAC-CAACGGGAATT. The probe corresponding to the variantallele (labeled with fluorescent VIC) wasTCCACATCCTTGGCACCTATTCCAACTTTCGGAAC-CAACGGGAATT.For ... not available), the forward primer was 5'-CAG-GGTTCTTGCCATAAAGTAGACA-3', and the reverseprimer was 5'-GCACCATGTTGACACCAATTCC-3'. Theprobe corresponding to the reference allele...

Xem thêm