báo cáo khoa học: "Chest pain with ST segment elevation in a patient with prosthetic aortic valve infective endocarditis: a case report" ppsx
báo cáo khoa học: "Chest pain with ST segment elevation in a patient with prosthetic aortic valve infective endocarditis: a case report" ppsx
... 5:408 http://www.jmedicalcasereports.com/content/5/1/408 Page 2 of 3 JOURNAL OF MEDICAL CASE REPORTS Chest pain with ST segment elevation in a patient with prosthetic aortic valve infective endocarditis: a case report Luther et al. Luther et al. ... with prosthetic aortic valve infective endocarditis: a case report Vishal Luther 1* , Refai Sho...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo khoa học: "The role of adjuvant pelvic radiotherapy in rectal cancer with synchronous liver metastasis: a retrospective study" doc
... clinical fac- tors including patients’ age, Duke stage, initial CEA level, lateral resection margin, liver metastasis stage, local treatment for liver metastasis, an d adjuvant pelvic RT, in ... to Pettavel and Morgenthaler staging [12]. Stage I was defined as a solitary or small metastasis, stage II was defined as two or three metas- tases with a maximum diameter less than or equal t...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học:"The hierarchy of stability and predictability in orthognathic surgery with rigid fixation: an update and extension" ppt
... Improved stability has been demonstrated in patients (usually Class III) in whom downward move- ment of the maxilla is combined with a mandibular ramus osteotomy. Widening the maxilla with a segmental ... important to keep in mind that there is not a normal distribution of post-surgi- cal or post-treatment change. Instead, most of the changes occur in a few of the patients...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo khoa học:" Biochemical typing of pathological prion protein in aging cattle with BSE" ppt
... (Charly-04) with a) a core-binding antibody (Sha31), b) an amino-terminal binding antibody (12B2) and c) a carboxy-ter- minal binding antibody (SAF84). Samples are assigned to the lanes as ... diluted in Lämmli buffer and reanalyzed until a clear banding pattern was observed. A biotinylated molec- ular mass marker (2 lanes, Sigma) and a C-type brainstem control sample from a...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: "Assessment of six mortality prediction models in patients admitted with severe sepsis and septic shock to the intensive care unit: a prospective cohort study" ppt
... Al-Shimemeri 1 1 Department of Intensive Care, King Fahad National Guard Hospital, Riyadh, Saudi Arabia 2 Department of Infection Prevention and Control, King Fahad National Guard Hospital, Riyadh, Saudi Arabia Correspondence: ... using standardized defini- tions in a non-Western country. Materials and method King Fahad National Guard Hospital is a 550-bed tertiary care teaching centre...
Ngày tải lên: 12/08/2014, 19:22
Báo cáo khoa học: "Factors of influence upon overall survival in the treatment of intracranial MPNSTs. Review of the literature and report of a case" doc
... 1998, 82(3):545-552. 10. Hanabusa K, Morikawa A, Murata T, Hanabusa K, Morikawa A, Murata T, Taki W: Acoustic neuroma with malignant transformation. J Neurosurg 2001, 95:518-521. 11. Gonzalez LF, Lekovic GP, Eschbacher ... tract and facial nerve function was achieved. Postoperatively, a transient facial nerve palsy House- Brackmann grade III occurred as sole complication. Histopathologi...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học: " Identification of amino acid residues involved in substrate specificity of plant acyl-ACP thioesterases using a bioinformatics-guided approach" pptx
... CCTGCAGATGATTTGC GACGGTTTCTAT KQF TAATCATGTTCAG ACTGCTGGATTGCTTGG KQR CCAAGCAATCCAGCAGTCTG AACATGATTA VTF GATATGGGTTACT ACTCGTATGC VTR GCATACGAGT AGTAACCCATATC MTF GGAAAGAATGGTACT CGTCGTGATTGGCT MTR AGCCAATCACGACGAGT ACCATTCTTTCC SQF ... A FatB CAD32683 NP189147 CAC39106 NP193041 S40407 Q42712 AAA33020 AAG43859 AAL77443 AAG35064 AAB51523 AAB51524 AAC72883 Q39473 AAC49001 Q41635 AAD42220 AAG...
Ngày tải lên: 12/08/2014, 05:20
Tài liệu Báo cáo khoa học: Suppressed catalytic efficiency of plasmin in the presence of long-chain fatty acids Identification of kinetic parameters from continuous enzymatic assay with Monte Carlo simulation ppt
... truncated plasmin variants was examined (Fig. 8). Miniplasmin (des-kringle 1-4 plasmin) con- tains the kringle 5 and the catalytic domain of plas- min, whereas microplasmin (des-kringle 1-5 plasmin) ... catalytic domain only [11]. At a satu- rating concentration of Spectrozyme-PL, all three fatty acids affected the activity of miniplasmin in the same manner as that of plasmin; apparent ac...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt
... of His-tagged NDH-2 The AtuNDH-2 gene was amplified from A. tumefaciens ge- nomic DNA, using the following couple of primers: (F) CGCCAATTGATGCAAGAACATCATGTT; (R) AAAA CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG. ... nickel-affinity chro- matography (A) and analysis of the flavinic cofactor (B). (A) Coo- massie Brilliant Blue-stained SDS ⁄ PAGE and western blot analysis using an anti-histidin...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc
... QLD, Australia). Plasmids and cDNAs The mammalian expression plasmid, pcDNA3 (Invitrogen, Melbourne, VIC, Australia), containing N-terminally flag- tagged human Salvador (hSav) cDNA was a kind ... Mst. Mst: Salvador: Δ433 WT Δ374 Δ344 Δ321 Δ268 Δ199 WT 199-383 268-383 321-383 kinase domain inhibitory domain coiled-coil domain WW domains coiled-coil domain Fig. 2. The structure of Mst kinase...
Ngày tải lên: 19/02/2014, 06:20