báo cáo khoa học: "Anomalous origin of the left coronary artery from the pulmonary artery associated with an accessory atrioventricular pathway and managed successfully with surgical and interventional electrophysiological treatment: a case report" docx
báo cáo khoa học: "Anomalous origin of the left coronary artery from the pulmonary artery associated with an accessory atrioventricular pathway and managed successfully with surgical and interventional electrophysiological treatment: a case report" docx
... 5:384 http://www.jmedicalcasereports.com/content/5/1/384 Page 2 of 4 CAS E REP O R T Open Access Anomalous origin of the left coronary artery from the pulmonary artery associated with an accessory atrioventricular pathway and managed successfully with ... tomography, was diagnosed with an anomalo us left coronary artery origin from the...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo khoa học: Solution structure of long neurotoxin NTX-1 from the venom of Naja naja oxiana by 2D-NMR spectroscopy pot
... Tehran, Iran The N MR solution structures of NTX-1 (PDB code 1W6B and BMRB 6288), a long neurotoxin isolated from the venom of Naja naja oxiana, and the molecular dynamics simulation of these ... methods Sample preparation and purification Central Asian cobra ( Naja naja oxiana) s nakes were collected, m ilked and the pooled venom lyophilized and Correspondence to H...
Ngày tải lên: 23/03/2014, 13:20
Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx
... were analyzed in a semi-automated iterative manner by cyana 2.1 [38]. The NOE coordinates and intensities used as input for automated analysis were generated auto- matically by Sparky based on the ... have determined the structure of HtA by NMR methods. The structure consists of one a- helix, a helical turn and seven b-strands that form an N-terminal hairpin and an...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc
... (IAA), which is synthe- sized by plants [1,2] and plant -associated bacteria [3,4]. Several pathways for the synthesis of IAA in these organisms have been described, and most of them start from L -tryptophan ... conformational changes during catalysis, and these structural features explain the lack of substrateactivationinZmPDC.InIPDC,theassemblyof the subunits in the t...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FEBS Introduction Staphylococcus aureus, one of the most important Gram-positive pathogens of humans and animals, is a highly versatile bacterium capable of causing a wide spectrum of diseases, ranging from ... measurements, with immobilized 15E11 as ligand and FnBRs of FnBPA and FnBPB as analytes. K on , association rate constant; K off , dissociation con- stant; K...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc
... with basal bodies of the non-motile dorsal cilia and of all of the cirri of the ventral surface (i.e. adoral membranelles, paraoral mem- brane, and frontoventral transverse, caudal and marginal ... estimate that the accuracies of the modeled structures of c-T1 and c-T2 approach 3 A ˚ [62]. Poly [A] + RNA purification, cDNA synthesis and cloning, and Southe...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... On the basis of low J 3,4 and J 4,5 values (<4 Hz) and chemical shift data, the residues with anomeric resonances at d 4.46, 4.94, 4.52, 4.91 and 4.62 were attributed to the t-Gal (GalI and ... H-3 and H-5 resonances (b-configur- ation) or between H-1 and H-2 (a- configuration). On the basis of the chemical shift data and the large J 2,3 , J 3,4 and Table 4....
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Identification of two cysteine residues involved in the binding of UDP-GalNAc to UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) ppt
... sequence. Highlyconservedcysteineresiduesarerepresentedbydottedlines.b,r,hT1,bovine,rat,andhumanGalNAc-T1;hT2,humanGalNAc-T2;hT3, human GalNAc-T3; hT4, human GalNAc-T4; rT5, rat GalNAc-T5; hT6, human GalNAc-T6; hT7, human GalNAc-T7; hT8, human GalNAc-T8; hT9, human GalNAc-T9; rppGaNTase-T9, rat ppGaNTase-T9. Ó ... other GalNAc-transferases contain different amino acids at these positions, suc...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf
... pET-AmyH as template, with primers AmyFor-NdeI (TTTGTTTAACTTTAAGAAGG AGATATA CATATGAATCG) and AmyRev-NcoI (aaaac catGGGCTTTGTTAGCAGCCGGAT). The amplified fragment was ligated into the NdeI and ... template, and prim- ers AmyH-T 7a (atat catATGAATCGACCCCGAATTACC GGCAG) and AmyH-T7b (atat aagcttGTCTCCGTGGCG TGCCAGCTTACTG), and cloned into the NdeI and HindIII sites of plas...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Protective effects of endomorphins, endogenous opioid peptides in the brain, on human low density lipoprotein oxidation pdf
... presence of an antioxidant molecule, AH, either the initiating peroxyl radical and ⁄ or the propagating lipid peroxyl radical can be trapped and a new antioxidant radical, A • , produced. If the A • is ... However, the great pharmacological disadvantages of many antioxi- dants are their very limited passage through the blood–brain barrier [14]. Therefore, the exist...
Ngày tải lên: 23/03/2014, 10:21