báo cáo khoa học: "Blunt cerebrovascular trauma causing vertebral arteryd issection in combination with a laryngeal fracture: a case report" ppsx
báo cáo khoa học: "Blunt cerebrovascular trauma causing vertebral arteryd issection in combination with a laryngeal fracture: a case report" ppsx
... CAS E REP O R T Open Access Blunt cerebrovascular trauma causing vertebral arteryd issection in combination with a laryngeal fracture: a case report Michael Frink 1* , Carl Haasper 1 , Kristina ... 128:213-218. doi:10.1186/1752-1947-5-381 Cite this article as: Frink et al.: Blunt cerebrovascular trauma causing vertebral arteryd issection in combinati...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo khoa học: "Prehospital advanced trauma life support: how should we manage the airway, and who should do it" ppsx
... Lewan U, Nast-Kolb D, Working Group on Multiple Trauma of the German Trauma Society: Pre- hospital intubation in severe thoracic trauma without respira- tory insufficiency: a matched-pair analysis ... personnel may not be able to master anaesthesia and intubation in trauma patients, because their data were collected in a physician-based emergency care system. They relate the...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx
... using menadione as an analogue of menaquinone and duro- quinone as an analogue of ubiquinone, and comparing the results with those obtained with dithionite. The spectropho- tometric studies indicate ... measurement of baselines were established at each wavelength with anaerobic buffer, and the values obtained were typically within 5% of those obtained from the absorbance spectra of the...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Crystal structure of the parasite inhibitor chagasin in complex with papain allows identification of structural requirements for broad reactivity and specificity determinants for target proteases pptx
... ACS, Abrahamson M, Lima APCA, Vannier- Santos MA & Scharfstein J (2001) Identification, char- acterization and localization of chagasin, a tight-binding cysteine proteases inhibitor in Trypanosoma ... chagasin and cystatin B with papain. Color coding: chagasin (green)–papain (pink); cystatin B (brown)–papain (gray). (A) Stereoview of aligned molecules created by superposition of the...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Identification of three proteins that associate in vitro with the Leishmania (Leishmania) amazonensis G-rich telomeric strand pdf
... 5¢- AATTAACCCTCACTAAAGGG-3¢ T7 5¢- GTAATACGACTCACTATAGGG-3¢ TS 5¢- AATCCGTCGAGCAGAGTT-3¢ OvhF 5¢- CTGGCCGTCGTTTTACTTAGGGTTAGGGTT AGG -3¢ OvhR 5¢- GTAAAACGACGGCCAG-3¢ CSB1 5¢- GTACAGTGTACAGTGTACAGT-3¢ 5¢ ... annotated as Rpa1, lacked the N-terminal domain (data not shown) that in other eukaryotes is involved only in Rpa–protein interactions and has no function in binding DNA [ 45]. In...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Crystal structures of bovine odorant-binding protein in complex with odorant molecules doc
... Sicurezza degli Alimenti, Universita ` di Parma, Parma, Italy The structure of bovine odorant-binding protein (bOBP) revealedastrikingfeatureofadimerformedbydomain swapping 2 [Tegoni, M ., Ramoni, ... receptor, as in bacterial chemotaxis [ 14,15]. 5 Indeed, a broad spectrum of activity and a relatively weak affinity for odorants have been found in mammalian OBPs [ 9,12,16– 18], and c l...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: " Definitive radiotherapy and Single-Agent radiosensitizing Ifosfamide in Patients with localized, irresectable Soft Tissue Sarcoma: A retrospective analysis" pptx
... contributions All authors read and approved the final manuscript. FE: acquisition of data and data analysis, statistical analysis, writing and drafting of the manuscript. CM: acquisition of data and data analysis. ... higher, dose adaptations were made to achieve sparing of organs at risk. The aim was a safety margin of 2 cm in all direc- tions. It was reduced in case of respected ana...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: " Long-term outcome and patterns of failure in patients with advanced head and neck cancer" pps
... was an independent risk factor for the appearance of isolated distant metastases in oral and oropharyngeal squamous cell carcinoma [16]. In our patient group, the stage of nodal disease was a ... mation in our analysis started at the initial diagnosis of the oro- or hypopharyngeal carcinoma. In general the salvage rates for distant failure were poor. Spector et al reported a curin...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Prognostic significance of IDH-1 and MGMT in patients with glioblastoma: One step forward, and one step back" pot
... such as cisplatinum might inactivate or attenuate MGMT-status thus influencing the clinical outcome when combined with alkylating chemotherapies. An important differential explanation is the variation ... cllinical data. SC and JD performed the clinical analysis of the dataset. CH and AvD performed the histopathological and molecular analysis. SC, JD, CH and AA analyszed the prognostic...
Ngày tải lên: 09/08/2014, 09:21
báo cáo khoa học: "Factors that contribute to long-term survival in patients with leukemia not in remission at allogeneic hematopoietic cell transplantation" pot
... variables delineated subgroups with different long- Table 2 Univariable analysis of impact of pre-transplant variables on overall survival Variable Survival (% at 5 y) Log rank P value Age at allo-HCT < ... respectively. Figure 3 Kaplan-Meier estimates of overall survival based on a landmark analysis at 6 months post-transplant, grouping patients according to percent marrow blast (≤ or...
Ngày tải lên: 10/08/2014, 10:21