báo cáo khoa học: "Splenic autotransplantation in a patient with human immunodeficiency virus infection: a case report" pot
... 5:379 http://www.jmedicalcasereports.com/content/5/1/379 Page 3 of 3 CAS E RE P O R T Open Access Splenic autotransplantation in a patient with human immunodeficiency virus infection: a case report Adriana Toro, Maurizio ... 215:256-260. 9. Takayasu H, Ishimaru Y, Tahara K, Otani Y, Yamagishi J, Ikeda H: Splenic autotransplantation for a congested and enlarged wander...
Ngày tải lên: 10/08/2014, 22:24
... 5¢-TA ATACGACTCACTATAGGGCGAATAGGCGGGAATT TTGCATC-3¢ containing the T7 polymerase promoter sequence, and TMV4 (downstream) 5¢-CAATACTGT CTTTCTGGCCTTC-3¢. TMV RNA was transcribed in vitro using ... genome within the replicase-coding sequence (ORF 1) was an additional advantage. The designed catalytic strand of the leadzyme was a 16-nucleotide RNA (5¢-ACAUAUGGAGUCCCUU-3¢), and its binding to...
Ngày tải lên: 16/03/2014, 12:20
... 2004, 9:318-325. 8. Schinazi RF, Chu CK, Babu JR, Oswald BJ, Saalmann V, Cannon DL, Eriksson BF, Nasr M: Anthraquinones as a new class of antiviral agents against human immunodeficiency virus. Antiviral Res 1990, ... Mark.Widrlechner@ARS.USDA.GOV; Kathleen Delate - kdelate@iastate.edu; Ganesh Kumar - lganeshk@iastate.edu; George A Kraus - gakraus@iastate.edu; Ludmila Rizshsky - ludm...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: "Survival rate in nasopharyngeal carcinoma improved by high caseload volume: a nationwide population-based study in Taiwan" docx
... information was not available from the database. However, Begg et al., using a SEER-Medicare linked database, reported that cancer stage and patient age were independent of caseload volume [24]. Instead ... Nasopharyngeal Carcinoma Survival Rate and Adjusted Hazard Ratios by Physician Caseload Groups and the Characteristics of the Patients and Providers (n = 1225) Variable Adjusted hazard...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học: "Precocious puberty in an infant with hepatoblastoma: a case report" doc
... IS and FAM collected the clinical data. FA obtained and interpreted radiological studies. UA and IS reviewed the literature. IS gave approval for the final manuscript. All authors read and approved ... VV: Clinical, hormonal and ultrastructure studies of a virilizing hepatoblastoma. Acta Paediatr Scand 1978, 67(3):389-392. 8. Nakagawara A, Ikeda K, Tsuneyoshi M, Daimaru Y, Enjoji M, Watana...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: " Implementing change in primary care practices using electronic medical records: a conceptual framework" potx
... characteristics. An integrated approach [30] to qualitative data analysis was used that incorpo- rated inductive code generating, as well as a deductive organizing framework from the multiple theoretical per- Publish ... implementation and evaluation criteria, program developers and teams can stimulate improvements in their practice settings. Investing in collaborative team development...
Ngày tải lên: 11/08/2014, 05:22
báo cáo khoa học: " Review of "In the Eye of the Needle: Diary of a Medically Supervised Injecting Centre" by Ingrid van Beek Allen & Unwin 2004" potx
... centres around the globe. The most recent have appeared in Vancouver, Canada, and the most scrutinized is in Sydney, Australia. Dr. Ingrid Van Beek has diarized the early history of Sydney's ... reducing the negative consequences of injecting in public places and are usually staffed by medi- cal professionals and social workers. Injecting in uncon- trolled spaces leads to missed...
Ngày tải lên: 11/08/2014, 20:20
Báo cáo khoa học: "Anaphor resolution in unrestricted texts with partial parsing" doc
... texts with partial parsing A. Ferr~indez; M. Palomar Dept. Languages and Information Systems Alicante University - Apt. 99 03080 - Alicante - Spain antonio@dlsi.ua.es mpalomar@dlsi.ua.es ... lexical reiteration, ). We will work in a similar way to this approach, since we use some of its antecedent indicators, but we automatically apply a partial parsing that allows us to deal...
Ngày tải lên: 08/03/2014, 05:21
Báo cáo khoa học: "Undestanding Stories in Different Languages with GETA-RUN" doc
Ngày tải lên: 09/03/2014, 01:20