báo cáo khoa học: "Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin" potx
... unmethylated form (154 bp) were tgtgatgtgtttgtattttgtggtt (positive sense) and ccatacaataaccaaacaaccaa (antisense). The amplification was performed in an Mastercycler unit (Eppendorf) under the program ... RESEARC H Open Access Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism...
Ngày tải lên: 10/08/2014, 22:21
... (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); ... RT-PCR was performed on DNAse- treated RNA extracts. Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGC...
Ngày tải lên: 07/03/2014, 16:20
... cells, suggesting that GM1-CTx internalization occurs through a clathrin-independent process, or that clath- rin -mediated internalization is a relatively minor path- way in these epithelial cells. After ... suggest that GM1-CTx internaliza- tion in MDCK cells occurs through a clathrin-indepen- dent process, or that clathrin -mediated internalization is a relatively minor p...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Inhibition of urokinase receptor gene expression and cell invasion by anti-uPAR DNAzymes in osteosarcoma cells pot
... 5¢-CTTCGGGAA GGCTAGCTACAACGAAGGTGACAG-3¢ Dz372 (mutant) 5¢-TTCGGGAAC GGCTAGCTACAACGAAGTGGACGA-3¢ 372 nt Dz483 (active) 5¢-GTCACCACA GGCTAGCTACAACGACCAGGCACT-3¢ Dz483 (mutant) 5¢-ACACCACTG GGCTAGCTACAACGATCACGGACC-3¢ 483 nt Dz720 (active) ... combination of both DNAzyme half-life and the multicompartmental state of uPAR, such that the concentration of uPAR mRNA must be maintained at low conc...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: "Changing of Women’s Roles in Agricultural and Handicraft Production: A Case Study in Kim Thieu Village, Tu Son District, Bac Ninh Province" pdf
... pre-collectivization, villagers lived mainly by farming, animal rearing and partly on woodcarving activities. The reason was the fact that rice cultivation alone was not able to make a village a ... gender in work differentiation can be changed accordingly to the variation of economic, social and political conditions. The data and information demonstrate that the clear...
Ngày tải lên: 06/08/2014, 19:20
Báo cáo khoa học: "Lack of mother tree alleles in zymograms of Cupressus dupreziana A. Camus embryos" ppsx
... dupreziana seeds. In most Cupressaceae studied, such a paternal inheri- tance was already observed for both chloroplast and mitichondrial DNA, while in Pinaceae mitochondrial DNA is usually maternally ... (seed trees) indicate the existence of other genotypic combinations among pollinating trees. Due to the geographic isolation of the plantation, these alleles should mainly come fr...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt
... total biomass. Total biomass production of the biannual treatment was 78% of the pro- duction of the annual treatment in the sec- ond year, 26% in the third year, and ... stool mortality and of individual stool biomass to the decrease in production of the biannual treatment compared to the annual treatment (table II). Total dry woody bioma...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo khoa học: "The role of ectomycorrhizal fungi in calcareous soil tolerance by "symbiocalcicole" woody plants" doc
... could in- teract with iron in the soil as well as in the plant organs, counteracting any inactiva- tion. CONCLUSION A characteristic difficulty in understanding the behaviour ... is an acid as well as chelating agent and after excretion in the soil it is particularly effi- cient in minerals alteration (Robert et al, 1979). In calcareous...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo khoa học: "MicroRNA expression after ionizing radiation in human endothelial cells" ppt
... them to radiation. Since radiation up-regulates let-7g, the data also indicate that the miRNA up-regula- tion is correlatively or causatively associated with the direct anti-endothelial radiation ... microRNA is another potential candidate in our system linking functional cell death with effects of radiation. Interestingly, our data showed that the radiation sensitivity itself in endothel...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo khoa học: "Radiation Induced Temporal Lobe Necrosis in Patients with Nasopharyngeal Carcinoma: a Review of New Avenues in Its Management" doc
... believe that pre-treatment EBV DNA concentrations mainly reflect tumor load whereas post treatment EBV DNA concentrations are an important predictive factor for distant metastases [45]. Leung et al ... press. 55. Tada E, Matsumoto K, Kinoshita K, Furuta T, Ohmoto T: The protective effect of dexamethasone against radiation damage induced by interstitial irradiation in normal monk...
Ngày tải lên: 09/08/2014, 09:21