báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
... Hoshida Y, Xu JX, Fujita S, Nakamichi I, Ikeda J, Tomita Y, Nakatsuka
S, Tamaru J, Iizuka A, Takeuchi T, Aozasa K: Lymphoproliferative
disorders in rheumatoid arthritis: clinicopathological analy-
sis ... Bone marrow (BM) examination
revealed an increase of myeloid blasts (23.1%) with dys-
plasia in three myeloid cell lineages (Figure 1A) , and a
diagnosis of AML-MLD...
báo cáo khoa học: "CD7 in acute myeloid leukemia: correlation with loss of wild-type CEBPA, consequence of epigenetic regulation" potx
... sequences were as follows: FPCEBPA: 5'-
GATCCCCGGCCAAGAAGTCGGTGGACTTCAAGA
GAGTCCACCGACTTCTTGGCCTTTTTTGGAAG-3';
RPC EBPA: 5'-CGACTTCCAAAAAAGGCCAA-
GAAGTCG GTGGACTCTCTTGAAGTCCACCGACT-
TCTTGGCCGGG-3'.
The ... with
GAPDH as internal control. CD7 forward: 5'-GTG CTG
GCG AGG ACA CAG-3'; CD7 reverse: 5'-TCG TAC
ACC ACA CAT GCC G-3'. GAPDH forward: 5'-TG...
Báo cáo y học: "Infiltration of the synovial membrane with macrophage subsets and polymorphonuclear cells reflects global disease activity in spondyloarthropathy" pps
... http://arthritis-research.com/content/7/2/R359
R361
vascularity of the sublining layer, infiltration of the sublining
layer, and the presence of lymphoid aggregates, plasma
cells, and PMNs. A separate analysis in 93 samples
showed that the evaluation of ... duration,
and treatment.
Prediction of global disease activity in individual SpA
samples
Since the previous data p...
Báo cáo khoa học: "Coexistence of carcinoma and tuberculosis in one breast" ppsx
... node within the paratracheal, internal
mammary, or axillary nodal basin [9]. Histologically, TM
can be classified into nodular which mimics carcinoma;
disseminated which causes caseation and sinus ...
Hospital, Manchester, UK
Email: Ahmed Alzaraa* - ahmedwahabf@gmail.com; Neha Dalal - neha.dalal@tgh.nhs.uk
* Corresponding author
Abstract
Background: The coexistence of breast cancer and...
Tài liệu Báo cáo khoa học: Structure of RNase Sa2 complexes with mononucleotides – new aspects of catalytic reaction and substrate recognition pptx
... RNase Sa2, correspond
to Val43 and Gln32 in RNase Sa, Arg61 and
Lys26 in binase, and Ala60 and Lys27 in
barnase.
Structures of RNase Sa2–mononucleotide complexes V. Bauerova
´
-Hlinkova
´
et al.
4164 ... RNase Sa [31]. An R6 5A
mutation in RNase Sa caused k
cat
to decrease by three
orders of magnitude. Because Arg65 in RNase Sa is
structurally equivalent to Arg67 in R...
Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity pdf
... determination,
enzyme assays and materials
CT -A and CT-B, native CT, acridine orange and pepsta-
tin A were purchased from Sigma (St Louis, MO, USA). A
nontoxic diphtheria toxin CRM 197 mutant and bafilomy-
cin -A1 ... compartmentalization and cytotoxic action of cholera toxin in
rat liver parenchyma. Following administration of a saturating dose of
cholera toxin to r...
Tài liệu Báo cáo khoa học: "Evaluation of Machine Translations by Reading Comprehension Tests and Subjective Judgments" doc
... indicate that a good deal of
information is available in machine translations, they
are also consistent with the view that it is less readily
available than in human translations. They also suggest ... be of some use.
Summary and Conclusions
Evaluation of the quality of machine translations by
means of a test of reading comprehension and by judg-
ments of se...
Tài liệu Báo cáo khoa học: "Part-of-Speech Tagging for Twitter: Annotation, Features, and Experiments" pdf
... Finin, Will Murnane, Anand Karandikar, Nicholas
Keller, Justin Martineau, and Mark Dredze. 2010. An-
notating named entities in Twitter data with crowd-
sourcing. In Proceedings of the NAACL HLT 2010
Workshop ... Creating Speech and Language Data
with Amazon’s Mechanical Turk.
John Lafferty, Andrew McCallum, and Fernando Pereira.
2001. Conditional random fields: Probabilistic m...
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx
... [15,17,18], and
amino acids and proteins [12,19,20]. Proteins are major
biological targets as a result of their abundance and high
rate constants for reaction [21], with damage occurring
primarily at ... peptide and protein peroxides investigated in
the current study, with GAPDH being more sensitive than
GR and LDH, and inactivation of G APDH being metal-
ion independe...
Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc
... leading
mode is an activator, promoting the formation of the
lagging mode, and the lagging mode is an inhibitor of
Table 6. Stuart–Landau parameters of the models. The table lists
the Stuart–Landau ... was added (r ¼ storage), and the
removal of extracellular acetaldehyde (ACA) (r ¼ out-
ACA) was changed so that it is now formally com-
posed of the ACA leaving the reactor with...