báo cáo khoa học: "R-CHOP versus R-CVP in the treatment of follicular lymphoma: a meta-analysis and critical appraisal of current literature" ppt
Báo cáo khoa học: Structure–cytotoxicity relationships in bovine seminal ribonuclease: new insights from heat and chemical denaturation studies on variants ppt
... is the ellipticity at 222 nmat a given temperature, and Qmax and Qminare the maximum and minimum values of ellipticity corresponding to the denaturatedstate and native state of proteins,respectively.C. ... engendering a lowermelting temperature of the R80S variants.Urea denaturation of NCD forms The conformational stability of the NCD formsagainst the denaturing action of urea in comparisonwith the ... suggesting that the global architecture of all the variant proteins is very similar to that of the parent BS-RNase, and by the close similarity among the X-ray structures of swapped isoforms of hA-BS-RNase...
- 12
- 300
- 0
Báo cáo khoa học: "Successful enteral nutrition in the treatment of esophagojejunal fistula after total gastrectomy in gastric cancer patients" pps
... fluoro-scopy. In Figure 2 you can appreciate the le aking area, the fistula duct, as well as the naso-enteral tube locateddistally to the l eaking area. It was verified that the tubewas in the intestinal ... to the adequate place, in the intestinallumen,distaltothezoneofescape(Figure4).Thisemphasizes the importance of experience in the hand-ling of this alternative therapy. In this case, a radio-graphic ... had esophagojejunal fistula (5.2%) The diagnosis of this complication was suspectedbecause of the characteristics of the discharge obtainedfrom the d rain that was inserted during the intraopera-tive...
- 4
- 241
- 0
Báo cáo khoa học: "Intraoperative radiation therapy in the treatment of early-stage breast cancer utilizing xoft axxent electronic brachytherapy" ppt
... AccessTechnical innovationsIntraoperative radiation therapy in the treatment of early-stage breast cancer utilizing xoft axxent electronic brachytherapyAdam Dickler*1, Olga Ivanov2 and Darius Francescatti3Address: ... the volume of treatment and increasing the daily fraction size of the radiation, treat-ment can be accomplished in one week rather than the standard 6–7 weeks. The method of APBI with the longest ... withoutcontaminating the field. The catheter end was passedthrough a hole in the drape and a FlexiShield™ (FS) wasplaced on top of the drape (Figure 4). The FS is a lead-equivalent material, which...
- 6
- 499
- 0
Báo cáo khoa học: " Science review: Carnitine in the treatment of valproic acid-induced toxicity – what is the evidence" pot
... glutamine through the mitochondrialmembrane, thereby enhancing glutaminase activity. Ammoniais released as a result of the transformation of glutamine intoglutamate [78,79]. Both animal [76] and ... daily). Prolonged L-carnitinesupplementation was associated with normalization in plasmaammonia concentrations and marked increase in carnitineconcentration in all 15 patients. The plasma ammoniaconcentrations ... synthesis of N-acetyl glutamic acid (NAGA) fromacetyl-CoA and glutamate by NAGA synthetase (NAGA is animportant cofactor of CPS I).Carnitine supplementation in valproic acidinduced toxicityBecause...
- 10
- 476
- 0
Báo cáo y học: " Pentobarbital versus thiopental in the treatment of refractory intracranial hypertension in patients with traumatic brain injury: a randomized controlled trial" ppsx
... criteria [13]. Data are presented as number of cases and as a percentage of the total number of cases each day.Figure 1AUC of ICP dataAUC of ICP data. Presented are areas under the curve (AUCs) of ... 53:186-194.7. The Brain Trauma Foundation: The American Association of Neurological Surgeons. The Joint Section on Neurotrauma and Critical Care. Critical pathway for the treatment of estab-lished intracranial ... acquisition of data and patient randomization. JH acquired data and conductedpatient randomization. JMA acquired data and conductedpatient randomization. JMR conducted statistical analyses. GFconducted...
- 10
- 366
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a GSP-FwdNM_200751 ... system (AlphaIn-notech, San Leandro, CA, USA). The bands (inten-sity · area) were semi-quantified by densitometry usingALPHAVIEW Q software (AlphaInnotech), and averaged fromat least three independent...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf
... microliters of supernatantwas added to 175 lL of distilled water and 25 lL of ATPassay mix [Bioluminescent Somatic Cell Assay Kit (FL-AA);Sigma, St Louis, MO] containing luciferin and luciferase. The ... employed a mixture of 5mm malate and 25 lm palmitoyl-l-carnitine as oxidativesubstrates. State 2 respiration (resting) was measured afteraddition of oxidative substrates, and state 3 respirationafter ... expression in female hearts indicates thatmyocardial glucose metabolism may be increased in parallel. As optimization of glucose metabolism isincreasingly highlighted as a therapeutic interventionfor...
- 7
- 582
- 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... binding the ion and also for the rotationalmechanism of the ring. The c ring of I. tartaricus has11 negative charges that are equally distributed along the horizontal axis of the rotor [8]. A positive ... The C-terminal helices show a clear handedness, and two of the rings face in the opposite direction in the membrane to the other two, forming the same patternas in the AFM surface representation of Fig. ... averagesgenerated by translational and rotational alignment of single c rings showed the same stoichiometry(Fig. 2D,E). From both the raw data and averages of c rings, it was clear that they were...
- 9
- 773
- 0
Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx
... transcripts are found in the organizer of gastrula embryos, later in the prechordal plate and axial mesoderm (Fig. 2). By contrast, noggin2 tran-scripts are detected at the end of gastrulation in the axial ... othermembers of the TGF-b family, binding to and inhibit-ing these signaling molecules from binding to theirreceptors in the extracellular space, thus inhibiting ven-tralizing activities. Of these ... Techniques such as animal cap assays and mRNA injection, and, recently, morpholino knock-downs, have been and are the major tools for identifica-tion and functional assays of BMPs. Knockdowns of bmp2,...
- 8
- 845
- 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx
... Osanai K, Takahashi K, Nakamura K, Takahashi M,Ishigaki M, Sakuma T, Toga H, Suzuki T & VoelkerDR (2005) Expression and characterization of Rab38, a new member of the Rab small G protein ... bonded into a cylindrical barrel[3,4]. The b-barrel proteins have an unusual primarystructure with many strands of alternating hydrophi-lic and hydrophobic residues and a high abundance of aromatic ... material (P). Proteins were then analyzed by immunoblotting afterSDS ⁄ PAGE using antisera against the matrix-located mtHsp70, the membrane protein porin and GFP.Integral proteins in the mitochondrial...
- 9
- 554
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM