báo cáo khoa học: "Boerhaave syndrome as a complication of colonoscopy preparation: a case report" ppt

... report of a case of Boerhaave syndrome as a complication of excessive vomiting caused by colonoscopy preparation. The case suggests that patients who are prepared for a colonoscopy by drinking large ... et al.: Boerhaave syndrome as a complication of colonoscopy preparation: a case report. Journal of Medical Case Reports 2011 5:544. Submit your...

Ngày tải lên: 10/08/2014, 22:20

... thickness after topical application of pharmacogic agents. Am J Ophthalmol 1996, 121:319-321. 2. Mishima HK, Masuda K, Kitazawa Y, Azuma I: A comparison of latanoprost and timolol in primary open-angle ... ophthalmology, chapter 3A. ] Relaxation of the ciliary body muscles after treatment of latanoprostFigure 3 Relaxation of the ciliary body muscles after treatment of latanopro...

Ngày tải lên: 11/08/2014, 10:22

... example, asparagine to aspartic acid, or glutamine to glutamic acid changes [14]. The a- conotoxins EpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine residues [5,10,21,23,24] (Table ... and utility of the pool of available a- conotoxins. Their identification andcharacterizationdependonasuiteoftechniques with increasing emphasis on mass spectrometry and micro- scale chromat...

Ngày tải lên: 19/02/2014, 12:20

... example. 2.1 Task representation and evaluation method To formulate the task as a machine-learnable classi- fication task, we use a representation that encodes the joint task of chunking and function-tagging ... function tag- ging task is easier thanfindinggrammaticalrelations as we tag a headword of a chunk as e.g. a subject in isolation whereas grammatical relation assign-...

Ngày tải lên: 08/03/2014, 07:20

... of the available words to ob- tain the same classification accuracy as with the full feature set, even in high-accuracy cases such as PBA and BL. The effectiveness of a small subset of features ... DP data parameter j controlling penalties for misclassification of positive and negative cases is optimized as well (j = {10 −2 , 10 −1 , . . . , 10 2 }), since datasets are unbalance...

Ngày tải lên: 17/03/2014, 00:20

... mentioned at the end of the preceding sec- tion, as well as measures targeted at the revised scenario and the updated system capabilities—for example, an additional dialogue quality measure will assess ... using data au- 881 useful: more global measures such as how often the users look at the robot arms or at the objects on the table, as well as more targeted measures exam- ining...

Ngày tải lên: 17/03/2014, 01:20

... plasmid, empty plasmid, and the catalytically inactive S38 6A- PCSK9 plasmid, as well as D374Y-PCSK9 and S127R-PCSK9, were used as controls. The values relative to WT-PCSK9 are given as the mean ... 5) appeared to migrate normally. To study whether the abnormal migration of the mature forms of R19 4A- PCSK9 and D20 4A- PCSK9 was due to altered auto- catalytic cleavage, western bl...

Ngày tải lên: 23/03/2014, 07:20

... of archaeal proteasomes. 20S catalytic core of archaeal proteasomes in combination with various AAA ATPases and membrane associated Lon proteases may play role in stress response or turnover of ... of synthesized and natural substrates, azocasein, azoalbu- min, hemoglobin, casein, gelatin and egg albumin. The enzyme appears to prefer azocasein with Km 2 mg azocasein/ml. The enzyme had...

Ngày tải lên: 23/03/2014, 15:20

... C-terminal arginine, was designed as follows (Fig. 3A) . Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAG CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢,and5¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢,respect- ively, ... 5¢-GAGGTCGAC...

Ngày tải lên: 31/03/2014, 09:20

... epithelial and stromal cells. MMMTs were traditionally regarded as a subtype of uterine sarcomas or a mixture of true carcinoma and sarcoma, however several reports suggested a monoclonal origin of ... describes a case of malignant mixed Müllerian tumor arising in the lower peritoneum of a 72-year-old female patient. The patient presented with ascites, lower abdominal...

Ngày tải lên: 09/08/2014, 01:24