báo cáo khoa học: "DNA aneuploidy as a topographic malignant transformation pattern in a pleomorphic adenoma of long-term evolution: a case report" docx
báo cáo khoa học: "DNA aneuploidy as a topographic malignant transformation pattern in a pleomorphic adenoma of long-term evolution: a case report" docx
... 5:541 http://www.jmedicalcasereports.com/content/5/1/541 Page 7 of 7 CAS E REP O R T Open Access DNA aneuploidy as a topographic malignant transformation pattern in a pleomorphic adenoma of long-term evolution: a case ... high-grade carcinomas, with frequent metastases and disease-related deaths [3]. Long-term evolution of a PA might increase the risk...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo khoa học: "Estimating tree canopy water use via xylem sapflow in an old Norway spruce forest and a comparison with simulation-based canopy transpiration" pdf
... predicted canopy transpiration rate (E p ). During this time total water use was as high as 0.3 mm, which was less than the estimated capacity of easily available water in the ... of ther- moelectric methods in determining the zero line of sapflux, the values of E dark are reasonable in relation to estimations of easily available wat...
Ngày tải lên: 09/08/2014, 04:20
báo cáo khoa học: "Still too little qualitative research to shed light on results from reviews of effectiveness trials: A case study of a Cochrane review on the use of lay health workers" potx
... interviews, and a thematic analysis was carried out. Data collection and analysis was led by an experienced qualitative researcher. The main author of the randomised trial was also involved in the qualitative ... no information abou t data collection methods and/or data analysis. In at least four of these six cases, the qualitative data were not the only focus of the paper. In...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: "Percutaneous pedicle screw reduction and axial presacral lumbar interbody fusion for treatment of lumbosacral spondylolisthesis: A case series" pdf
... this anterior trajectory was deemed feasible in all cases on the basis of preo- perative imaging analysis. Therefore, a 2 cm paracoccy- geal skin incision was made and the presacral approach was ... spondylolisthesis at L5-S1 in all patients and an associated grade 1 spondy- lolisthesis at L4-L5 in one case. A standardized surgical protocol was used for each case. Each patient w...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: " DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks" potx
... [22]. Analy- sis of the RNAi lines indicated that AtLIG1 was required for the initial rapid phase of repair, with reduced AtLIG1 levels resulting in an increase in the half life of a DSB. This was ... region of AtLIG1 was amplified by PCR with primers incorporating XbaI and SwaI sites for the forward primer: 5'- GGTCTAGAGGCGCGCCGATACTGAATAAATTCCAGGA- CATC-3' (LIG1if) a...
Ngày tải lên: 12/08/2014, 03:20
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... con- taining 0.1 m NaCl, 5 mm CaCl 2 and 1 mgÆmL )1 bovine serum albumin and monitored as described above. The amidolytic activity of G37 2A- FVIIa and FVIIa was mea- sured by incubating G37 2A- FVIIa ... kinetic parameters were calculated by global fitting of binding data to a 1 : 1 model using the software Biaevaluation 4.1 supplied by the manu- facturer (Biacore AB). N-terminal pegy...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx
... GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTG HOXC13-ERE1 GCGTCTCCCTGTCCCTTTA CAGGTCTCCTGGGGTTCC HOXC13-ERE2 ... TTGCCGAGTATATTCCATTGC TCTGCTTTACCTCGCTGGAT HOXC13-ERE3 TTTCAGGCCCTTTGTTTCTC CGCGGGTAGTAGAAGTGGAA HOXC13-ERE4 TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense...
Ngày tải lên: 18/02/2014, 14:20
Báo cáo khóa học: ICAM-1 expression is highly NF-jB-dependent in A549 cells No role for ERK and p38 MAPK docx
... ERK pathway has been suggested to both enhance DNA binding activity as well as to phosphorylate downstream cofactors including CBP/p300 and positive cofactor 1 to increase the transactivational ... ICAM-1 has been shown by numerous studies to be an important factor in many allergic diseases such as asthma, where it not only plays a critical role in airway in ammation and the deve...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: ISC1-encoded inositol phosphosphingolipid phospholipase C is involved in Na+/Li+ halotolerance of Saccharomyces cerevisiae pptx
... subsequently, its binding to the calcineurin-dependent response element in a variety of promoters including that of ENA1.Asanalternative ,a ceramide-activated phosphatase rather than calcineurin may be considered ... activate calcineurin-signalling pathways. The transient accumulation of Ca 2+ due to the increase of phyto- and dihydrosp- hingosine-1-phosphate is well established...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo khoa học: "15-Ketodihydro-PGF2α, Progesterone and Cortisol Profiles in Heifers after Induction of Parturition by Injection of Dexamethasone" pot
... selected. Analytical methods 15-Ketodihydro-PGF 2α was analysed using a radioimmunoassay (Granström & Kindahl 1982). Heparin plasma was used for the analy- sis and all samples were analysed in duplicates. The ... (phase I). During phase II, blood samples were collected at 10 min intervals. As soon as any part of the calf was visible from the outside, the sampling interval was ch...
Ngày tải lên: 12/08/2014, 15:20