Báo cáo y học: "Estimation of stature from the foot and its segments in a sub-adult female population of North India" pps

... in a sub-adult female population of North India. The study is intended to formulate standards for the estimation of stature from the foot and its parts in a sub-adult female population of North ... prominent part of the inner side of the ball of the foot, and the joint of the anterior epiphyses of the fifth metatarsal (mt....

Ngày tải lên: 10/08/2014, 21:24

... administration of epinephrine was a factor in many of the deaths [2]. Similar trends were seen in US mortality data recorded by the American Academy of Allergy, Asthma & I mmunology: between 1994 and ... evidence indicates that quality of life can be severely affected by food allergies in terms of restriction of social activities, increased fear and anxiety, la...

Ngày tải lên: 08/08/2014, 21:20

... transfection reagent (Neuromics, Edina, MN, USA) was administered intrathecally once daily for 7 days, starting from 1 day before CCI surgery. Evaluation of tactile allodynia and thermal hyperalgesia ... hyperalgesia The paw withdrawal latency (PWL) to radiant heat and paw withdrawal threshold (PWT) were used to evaluate thermal hyperalgesia and mechanical al- lodynia respe...

Ngày tải lên: 25/10/2012, 11:48

... of action of many of these products are poorly defined, or not at all. Thus, there is a need to systematically study and define the mechanisms underlying the activity of CAM products that have ... supernatant and (b) sera were obtained from Celastrus-fed and Water- fed rats as described in Materials and methods. The level of NO in these samples was determined...

Ngày tải lên: 09/08/2014, 10:20

... milliliter of media was analyzed with the Human Inflamma- tion Antibody Array III (Raybiotech), which can detect 40 dif- ferent cytokines, or the Human Matrix Metalloproteinase Antibody Array (Raybiotech), ... (Frederick, MD, USA). RayBio Human Inflammation Antibody Array III and Matrix Metalloproteinase Antibody Array were from Raybiotech (Norcross, GA, USA). IL-6 neutralizing anti...

Ngày tải lên: 09/08/2014, 10:23

... but paved the way for these changes on a site-specific scale. To test the hypothesis that dauer-induced chromatin changes can act as a ‘pacemaker’ for changes in local transcription, the authors ... their analysis to dauer, postdauer and control larvae they could further show that the altered gene expression observed in postdauer animals arises from multiple regulatory...

Ngày tải lên: 09/08/2014, 20:21

... B activation [22]. Similarly, the study by Singer et al. showed that p38 MAPK and NF-kappa B may affect COX-2 expression in human airway myocytes via separate signaling pathways given the fact ... 5' AGTACCGCAAGAGGTTTGGC 3', reverse: 5' GCCGTCTTGACAATGTTAAAGC 3'; COX-2: forward: 5' GACAGTCCA CCAACTTACAAT 3', reverse: 5' CATCTCTCCATCAATTATCTGAT 3&apos...

Ngày tải lên: 12/08/2014, 15:21

... Pisa, Italy Abstract The acute respiratory distress syndrome (ARDS) is an inflammatory disease of the lungs characterized clinically by bilateral pulmonary infiltrates, decreased pulmonary compliance and ... inflamma- tory manifestations of acute ventilator-induced lung injury in a rabbit model. Exp Lung Res 1995, 21:239–254. 25. Imai Y, Kawano T, Iwamoto S, Nakagawa S, Takata...

Ngày tải lên: 12/08/2014, 18:20

... involved in the extubation process; to potentially accelerate decision-making with regard to extubation; and to assess the safety and feasibility of our approach. Materials and method The intervention ... and other clin- ical team members were recorded. Data on duration of MV, duration of ICU stay and the rate of reintubation were collected. Safety The MDT agreed...

Ngày tải lên: 12/08/2014, 18:21

... Suite, and Stratagene's ArrayAssist ® . Many of them are extensions of previously known software products for standard arrays, and their major analytical aims overlap with those available in ... genome annotation and probeset location data that led to the development of a single inte- grated database rather than building a database containing only probe and probeset...

Ngày tải lên: 14/08/2014, 07:21