Báo cáo y học: "Lower limb biomechanics during running in individuals with achilles tendinopathy: a systematic review" potx

Báo cáo y học: "Lower limb biomechanics during running in individuals with achilles tendinopathy: a systematic review" potx

Báo cáo y học: "Lower limb biomechanics during running in individuals with achilles tendinopathy: a systematic review" potx

... [2,11,19] evaluated the association of a large number of dynamic plantar loading variables with Achilles tendinopathy. Findings showed those with Achilles tendi- nopathy demonstrated a significantly more ... biomechanics during running in individuals with achilles tendinopathy: a systematic review. Journal of Foot and Ankle Research 2011 4:15. Submit your next...

Ngày tải lên: 10/08/2014, 21:24

17 352 0
Báo cáo y học: "Different ways to repair the mitral valve with artificial chordae: a systematic review" potx

Báo cáo y học: "Different ways to repair the mitral valve with artificial chordae: a systematic review" potx

... Masuda M, Yasutsune T, Nishimura Y: Surgical application for prolapsed anterior mitral leaflet. Surg Today 2005, 35:812-818. 12. Minami K, Kado H, Sai S, Tatewaki H, Shiokawa Y, Nakashima A, ... Cardiovascular Surgery 1997, 5(1):125-128. 3. Murakami T, Yagihara T, Yamamoto F, Uemura H, Yamashita K, Ishizaka T: Artificial Chordae for mitral valve reconstruction in Children. Ann Thora...

Ngày tải lên: 10/08/2014, 10:20

6 325 0
Báo cáo y học: " Prolonged venous bleeding due to traditional treatment with leech bite: a case report" potx

Báo cáo y học: " Prolonged venous bleeding due to traditional treatment with leech bite: a case report" potx

... may be associated with morbidity such as serious bleeding and skin infec- tion. Anemia can of ten be seen with leech infestation. Erysipelas and skin abscess with Mycobacterium mari- num may also ... Her medical history was otherwise unremarkable. There was no bleeding dia- thesis and she was not taking any medication. On physi- cal examinatio n, she was a healthy woman with no find...

Ngày tải lên: 11/08/2014, 00:23

3 449 0
Báo cáo y học: " Effectiveness of psychotherapeutic, pharmacological, and combined treatments for chronic depression: a systematic review (METACHRON)" ppsx

Báo cáo y học: " Effectiveness of psychotherapeutic, pharmacological, and combined treatments for chronic depression: a systematic review (METACHRON)" ppsx

... Cochrane Collaboration; 2009. 34. Furukawa TA, Cipriani A, Barbui C, Brambilla P, Watanabe N: Imputing response rates from means and standard deviations in meta-analyses. Int Clin Psychopharmacol ... Sengupta ASB, J E, Williams JW, et al: Treatment of dysthymia and minor depression in primary care: a randomized trial in patients aged 18 to 59 years. J Fam Pract 2001, 50:405-412. 11....

Ngày tải lên: 11/08/2014, 16:22

6 304 0
Báo cáo y học: " Exacerbations of chronic obstructive pulmonary disease: When are antibiotics indicated? A systematic review" ppsx

Báo cáo y học: " Exacerbations of chronic obstructive pulmonary disease: When are antibiotics indicated? A systematic review" ppsx

... Switzerland Email: Milo A Puhan* - milo.puhan@usz.ch; Daniela Vollenweider - danivollenweider@yahoo.de; Tsogyal Latshang - Tsogyal.Latshang@usz.ch; Johann Steurer - johann.steurer@usz.ch; Claudia ... pulmonary disease: when are antibiotics indicated? A systematic review. Respira- tory research 2007, 8:30. 2. Anthonisen NR, Manfreda J, Warren CP, Hershfield ES, Harding GK, Nelson NA: An...

Ngày tải lên: 12/08/2014, 14:20

3 240 0
Báo cáo y học: " Exacerbations of chronic obstructive pulmonary disease: when are antibiotics indicated? A systematic review" doc

Báo cáo y học: " Exacerbations of chronic obstructive pulmonary disease: when are antibiotics indicated? A systematic review" doc

... bronchiectasis. We included trials evaluating any antibiotics that were administered orally or parenterally daily for a minimum period of at least three days. We chose three days because this is the minimum ... whether a watchful-waiting strategy is clinically not disadvantageous but associated with reduced use of anti- biotics. Factors other than treatment setting that may guide anti-...

Ngày tải lên: 12/08/2014, 15:20

11 506 0
báo cáo hóa học:" Heath-related quality of life in Spanish breast cancer patients: a systematic review" pptx

báo cáo hóa học:" Heath-related quality of life in Spanish breast cancer patients: a systematic review" pptx

... J, Sanchez-Perez MJ, Chirlaque MD, Larranaga N, Martinez-Cobo R, Tobalina MC, Vidal E, Marcos-Gragera R, Mateos A, Garau I, Rojas-Martin MD, Jimenez R, Torrella-Ramos A, Perucha J, Perez-de Rada ... Cancer” also being used as a key word; “Quality of life” AND “Breast cancer” in Dialnet; “quality” AND “life” AND “cancer” AND “breast” in IBECS; “quality of life” and “breast can- cer ” a...

Ngày tải lên: 20/06/2014, 15:20

10 480 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

... Sense: ACAGATGATGACACTGCCACC Antisense: CATAGTAGAGATATGGAGTGCTGC 55 324 35 Internal control EF1α Sense: AGGTGATTATCCTGAACCATCC Antisense: AAAGGTGGATAGTCTGAGAAGC 54 234 25 rt: primer pairs, that have ... ACGCCGACCAAGGAAAACTC Antisense: GTCCATAAACCACACTATCACCTCG 51 483 35 ALP (rt) Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC 51 454 IHH Sense: GAGGAGTCCCTGCATTATGA Antisens...

Ngày tải lên: 09/08/2014, 14:22

15 830 0
 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... disease 1 Injuries/diseases without any need for acute physician care 2 Injuries/diseases requiring examination and therapy by a physician but hospital admission is not indicated 3 Injuries/diseases without ... were admitted to Stavanger University Hospital. We defined severe trauma as a primary diagnosis of traumatic injury and a National Committee on Aeronautics severity of injury or...

Ngày tải lên: 25/10/2012, 09:56

6 612 0
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

... Australian and New Zealand Intensive Care Society; ANZICS-APD = Australian and New Zealand Intensive Care Society Adult Patient Database; APD = Adult Patient Database; ARCCCR = Australian and ... hospitals that had not intro- duced an MET service using the first year of data as baseline and the second year as comparator. Finally, an additional and similar analysis was performed for hospitals...

Ngày tải lên: 25/10/2012, 10:35

8 640 0
Từ khóa:
w