Báo cáo y học: "''''''''Foot'''''''' and ''''''''surgeon'''''''': a tale of two definitions" doc
Báo cáo y học: "''''Foot'''' and ''''surgeon'''': a tale of two definitions" doc
... JOURNAL OF FOOT AND ANKLE RESEARCH 'Foot' and 'surgeon': a tale of two definitions Menz et al. Menz et al. Journal of Foot and Ankle Research 2010, 3:30 http://www.jfootankleres.com/content/3/1/30 ... in this case is clearly driven by scope of practice, professional autonomy, m edico-legal and monetary considerations rather than a desire to anatomic...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: " Foot and ankle surgery in Australia: a descriptive analysis of the Medicare Benefits Schedule database, 1997–2006" potx
... study. HBM extracted, ana- lysed and interpreted the data, and drafted the manu- script. MFG and KBL assisted with data interpretation. All authors read and approved the final version of the manu- script. Additional ... Gilheany 1,2 and Karl B Landorf 1,2 Address: 1 Musculoskeletal Research Centre, Faculty of Health Sciences, La Trobe University, Bundoora, Victoria 3086, Austr...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Validation and test-retest reliability of the Royal Free Interview for Spiritual and Religious Beliefs when adapted to a Greek population" doc
... spirituality index of well-being: a new instrument for health-related Quality -of- Life research. Annals of Family Medicine 2004, 2(5):499-503. 15. Narayanasamy A: Nurses' awareness and educational ... different ways by different authors, some- times interchangeably because of the elusiveness of both concepts. Narayanasamy argues that the lack of any authoritative definiti...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Isotretinoin and psychopathology: a review" potx
... pharmacotherapy: a prescription sequence symmetry analysis. J Am Acad Dermatol 2003, 49:424-432. 31. Neary MP, Klaskala W, McLane J: Epidemiological study of adverse events in Accutane users and ... 98:12320-12322. 55. Sakai Y, Crandall JE, Brodsky J, McCaffery P: 13-cis retinoic acid (Accutane) suppresses hippocampal cell survival in mice. Ann NY Acad Sci 2004, 1021:436-440. 56. Crand...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Reproducibility and sensitivity to change of various methods to measure joint space width in osteoarthritis of the hip: a double reading of three different radiographic views taken with a three-year interval" pot
... stratum was 25. Radiographic techniques All radiographs were obtained at a standard size of 1/1 with the patient in a weight-bearing position. The X-ray beam was orientated AP, horizontal, and perpendicular ... magnifying glass. For each radiograph they were unaware of patient's identity, drug assignment, time sequence of the radiographs and each other's findings. Each...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC α 2 M GCCCGCTTTGCCCCTAACA 359 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 ... 287 AATAGCTTTACGGGTTTCAGG TIMP-1 TGGGCACCTGCACATCACC 277 CATCTGGGCCCGCAAGGACTG TIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277 TGTCCCAGGGCACGATGAAGTC TIMP-3 GATGTACCGAGGATTCACCA...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Foot and ankle injuries during the Athens 2004 Olympic Games." pdf
... basketball, handball, obstacle race and volley- ball compared to other sports (Table 3). The causes of injuries also varied substantially between the team sports. While 75% of gymnastic apparatus ... (Internal Medi- cine, Orthopaedics, Foot and Ankle, Ear-Nose-Throat, Dermatology, Gynaecology, Cardiology and Psychiatry), short-term observation room, Dentistry, Physical Ther- apy-Reh...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo Y học: Protein methylation as a marker of aspartate damage in glucose-6-phosphate dehydrogenase-deficient erythrocytes docx
... 2035 isomerization of aspartate residues [6]. Major targets of these alterations, also called Ôprotein molecular fatigue damageÕ [7], are cytoskeletal components, such as ankyrin and bands 4.1 and 4.2, as ... slice [6,9]. Radioactivity was expressed as d.p.m./band area. Determination of AdoMet and S -adenosylhomocysteine intracellular content Intracellular concentrations of AdoM...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: Anti- and pro-oxidant effects of urate in copper-induced low-density lipoprotein oxidation pdf
... and to chelation of transition metal ions [7–11]. Paradoxically, a lack of antioxidant activity of urate or even a pro-oxidant activity of urate have also been sometimes suggested. Atherogenesis ... Porkkala-Sarataho, E., Kaikkonen, J. & Salonen, J.T. (1997) Ascorbate and urate are the strongest determinants of plasma antioxidative capacity and serum lipid resistance...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: "Peanut sensitization in a group of allergic Egyptian children" pptx
... espec ially of food allergy, is agoodscreeningtesttoidentifyanindividualatriskof food allergy and the rate of allergy in a sibling of an Table 1 Clinical and laboratory data of the peanut sensitized ... study design and coordination, performed the statistical analysis, and drafted the manuscript. GG participated in collection of the study sample and data analysis. AS per...
Ngày tải lên: 08/08/2014, 21:20