Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx
... diagnosis and management of asthma over the past decade, as well as the availability of comprehensive and widely-accepted national and international clinical practice guidelines for thedisease[6,7],asthmacontrolinCanadaremains suboptimal. ... (ICSs) are the most effective anti-inflammatory medications available for the treat- ment of asthma and represent the mainst...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
... Party: Clinical Practice Guidelines for the management of melanoma in Australia and New Zealand Wellington: Cancer Council Australia and Australian Cancer Network, Sydney and New Zealand Guidelines ... spectrum of malignant melanoma of the nail apparatus. Semin Dermatol 1991, 10:82-87. 22. Franke W, Neumann NJ, Ruzicka T, Schulte K: Plantar malignant melanoma -...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... TBqÆmmol )1 . Binding and cAMP assay For the determination of the binding affinity and the biological potency of the photoactivatable CRF antagonists, HEK 293 cell lines, stably transfected with cDNA coding for rCRF 1 or ... Germany; 2 Institute for Molecular Biosciences, The University of Queensland, St Lucia, Australia A novel photoactivatable analog of antisauv...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: "Development of a health care utilisation data-based index for rheumatoid arthritis severity: a preliminary study" ppt
... the medical chart review. Using Spearman non-parametric tests, the correlations between the RARBIS and various forms of administrative data variables were then analysed. Data taken from one year before ... health care utilisation data indicators of RA severity We extracted the following information from the VA data- bases: rehabilitation visits (physical and occupational th...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx
... acquisition, analysis and interpretation of the data, and participated in drafting the manuscript. RG partici- pated in the analysis and interpretation of the data. SG con- tributed to the acquisition of ... the conception of the study, and the acqui- sition, analysis and interpretation of the data, and participated in drafting the manuscript. PSP con...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofi...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... context, the range of each measure across included footwear was also reported. Intra-rater and inter-rater reliability for all cate- gorical data was evaluated using percentage agreement, and kappa ... (greater medial than lateral wear at the heel and forefoot), which may indicate excessive pronation, or lateral (greater lateral than medial wear at the heel and forefoot), wh...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland County, which consist of ... performed at the discretion of the treating physician, and a variety of anaesthetic drugs are available to facilitate ETI. Written guidelines for pre-hospit...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... study, and performed the statistical analysis. RA conceived of the study, participated in the design of the study, performed the statistical analysis and Figure 4 Eosinophil cell count and C-reactive ... the acquisition of data. NM helped to draft the manuscript, and participated in the acquisi- tion of data. AZ participated in the coordination of the stu...
Ngày tải lên: 25/10/2012, 10:35
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... cells Kentaro Kogure, Motoki Morita, Susumu Hama, Sawa Nakashima, Akira Tokumura and Kenji Fukuzawa 1 Faculty of Pharmaceutical Sciences, University of Tokushima, Japan The effect of a- tocopheryl hemisuccinate ... electrophoretically to a poly(vinylidene difluoride) membrane. The membrane was treated with a rabbit anti-iNOS polyclonal antibody or rabbit anti-PKC polyclonal ant...
Ngày tải lên: 22/02/2014, 04:20