Báo cáo y học: "The paediatric flat foot proforma (p-FFP): improved and abridged following a reproducibility study" pptx
Báo cáo y học: "The paediatric flat foot proforma (p-FFP): improved and abridged following a reproducibility study" pptx
... common age of presentation, parentalconcern and clinical quandary regarding management[36].The paediatric flat foot proforma (p-FFP) provides a prag-matic standard by which paediatric flat feet ... collection.All authors participated in protocol development and read and approved the manuscript.References1. Sullivan JA: Pediatric flatfoot: evaluation and management.Journal of the American Academy ... imaging, which are largelyunsubstantiated in terms of the reliability and validity ofthe same. Flat feet, as a postural morphology, have longbeen associated with pain and disability (eg an exclusionfrom...
- 8
- 613
- 0
Báo cáo y học: "he paediatric flat foot and general anthropometry in 140 Australian school children aged 7 - 10 years" ppsx
... NoEvans Journal of Foot and Ankle Research 2011, 4:12http://www.jfootankleres.com/content/4/1/12Page 6 of 7JOURNAL OF FOOT AND ANKLE RESEARCHThe paediatric flat foot and generalanthropometry ... clear dis-parity, but this war rants further inquiry. Othe r unidenti-fied variables may also be proponents of altered foot posture in children. A standardized and ideally a vali-dated approach ... paediatric flat foot and generalanthropometry in 140 Australian school children aged 7 - 10 years.Journal of Foot and Ankle Research 2011 4:12.Submit your next manuscript to BioMed Centraland...
- 8
- 396
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... Grønlien, and Jan Nystuen from the area of Innlandet, Unni Eskeland and Olav Østebøfrom the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and TrondKibsgaard in the area of Haugesund. We want ... possibleNACA 5 Acute vital (life threatening) dangerNACA 6 Acute cardiac or respiratory arrestNACA 7 DeathZakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... erik.zakariassen@isf.uib.no1National Centre for Emergency Primary Health Care, Uni Health, Bergen,Norway, Kalfarveien 31, 5018 Bergen, NorwayZakariassen et al. Scandinavian Journal of Trauma,...
- 9
- 784
- 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc
... TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCCHJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGAHJ1 AGAAGCTCCATGTAGCAAGGCTAGHJ2 CTAGCCTTGCTAGGACATCTTCCGHJ3 CGGAAGATGTCCATCTGTTGTAGGHJ4 Bio-AAAAAACCTACAACAGATCATGGAGCTTCT5498 ... Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTADU2 TAGGCAGACTGACCCGGGAGCTGCTCGTACHJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTTHJ6 GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGCHJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCCHJ8 ... theprotein was altered.Table 3. Oligodeoxynucleotides.Name Sequence (5¢-3¢)ASP1 Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAGASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATTDU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTADU2...
- 10
- 672
- 0
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
... GPVI was functional, we measuredtyrosine phosphorylation of the FcR c-chain and thetyrosine kinase Syk, which is tyrosine phosphorylated and activated early after GPVI engagement. Phosphorylation ... ligand blotting as a band of 55 kDa.Additional bands of lower molecular mass are indicated. The associ-ated FcR c-chain was detected by Western blotting using a specificantibody. A sample of F1/c ... mice showed thatin vivo,theFcRc-chain was necessary for stable surfaceFig. 8. Transmembrane arginine and cytoplasmic tail of GPVI arenecessary for its association with FcR c-chain. (A) COS-7 cells...
- 10
- 506
- 0
Báo cáo Y học: The proximal cis-acting elements Sp1, Sp3 and E2F regulate mouse mer gene transcription in Sertoli cells potx
... 5¢-TGTCCAAGGGTGTACATATCAACAT-3¢ (Mer,sense )and5 ¢-AGCCGAGGATGATGAACATAGAGT-3¢ (Mer,antisense),which generated a 700-bp Mer PCR product; 5¢-CGGCATTCCCTTCAAGGAGAGT-3¢ (Gas6,sense )and 5¢-CTCAACTGCCAGGACCACCAACT-3¢ ... concentration of RNA was determinedby spectrophotometry at 260 nm, and its integrity wasassessed by agarose gel electrophoresis. PolyadenylatedRNA was prepared by oligo(dT) affinity chromatographyusing ... min.The reactions were separated by polyacrylamide gel elec-trophoresis (6%), and analysed by autoradiography.Site-directed mutation analysisSite-directed mutagenesis was performed according...
- 12
- 460
- 0
Báo cáo y học: "The tandem CCCH zinc finger protein tristetraprolin and its relevance to cytokine mRNA turnover and arthritis" pot
... UAUUUAUAUAUUUAUAUUUUUAAAAUAUUUAUUUAUUUAUUUAUUUAAGUUCAUAUUCCAHORSE UAUUUAUAUAUUUAUGUAUUUUAA-UAUUUAUUUAUUUAUUUAUUUAAGCUCAUACUCCAMOUSE UAUUUAUAUAUUUAUAUUUUUUAAAUAUUUAUUUAUUUAUUUAUUUAAWOODCHUCK UAUUUAUAUAUUUAUACUUUUAAAAUAUUUAUUUAUUUAUUUAUUGCOW ... UAUUUAUAUAUUUAUACUUUUAAAAUAUUUAUUUAUUUAUUUAUUGCOW UAUUUAUAUAUUUAUGUAUUUUAA-UAUUUAUUUAUUUAUUUAUUUAAACUCAUACCCCA DOG UAUUUAUAUAUUUAUGUAUUUUAA-UAUUUAUUUAUUUAUUUAUUUAAGAUCAUACUCUGPIG UAUUAACCUAUUUAUGUAUUUUAA-UAUUUAUUUAUUUAUUUAUCUAUUUAUUUAUUUA**** ... GAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUACBaboon GAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUACCow GAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUACGoat GAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUACMouse GAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUGCSheep...
- 17
- 416
- 0
Báo cáo y học: "The 5th annual European League Against Rheumatism congress in Berlin: a personal perspective" ppsx
... the education program coordinator and accountant. One must admire the efficiency of thissecretariat and congratulate EULAR on having such anable managing team. After 20 years in a small office, ... EULARjournal Annals of the Rheumatic Diseases, and alsoaccess to all educational events, unlike the AmericanCollege of Rheumatology (ACR), which charges extra forthese benefits. The biennial ... exhibition area was still closed and opened first at 9.30 a. m. From 8.15 to 9.45 a. m. everyday the only official activities were the satellite symposia, and delegates should perhaps not be tempted...
- 4
- 263
- 0
Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx
... CA,USA) and anion exchange chromatography on DEAE Sepha-rose (Pharmacia, Uppsala, Sweden) essentially as described[27]. Endotoxin content was determined by the lympholyticamoebocyte lysate ... responseagainst hnRNP -A2 in patients with RA [27]. We observed thatapproximately half of the RA patients harbor T cells againsthnRNP -A2 . In accordance with the perception of RA as aninflammatory, ... protein as described [27].Purification from bacterial lysates was achieved by Ni-NTAaffinity chromatography (Quiagen, Hilden, Germany) followedby Polymyxin B Sepharose adsorption (BioRad, Hercules,...
- 10
- 395
- 0
Báo cáo y học: "The proinflammatory cytokines IL-2, IL-15 and IL-21 modulate the repertoire of mature human natural killer cell receptors" pot
... for 5 and 7 days. On days5 and 7, cells were stained with several conjugated antibodies(see 'Cell staining for flow cytometry', above) and six-colouranalysis by flow cytometry was performed ... cytotoxicity assay. To test cytotoxicity, a standard 51Cr-release assay was performed. K562 cells were incubated for1 hour with Na2 51CrO4 (Hartmann Analytics, Braunschweig,Germany), ... byFACS and real-time PCR that IL-21 downregulates NKG2D and DAP10, respectively [24] (Figure 6c [left and right]).These data suggest that IL-21 regulates both adaptorsDAP10 and DAP12, leading...
- 15
- 370
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo giáo dục thể chất trường tiểu họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP