Báo cáo y học: "The paediatric flat foot proforma (p-FFP): improved and abridged following a reproducibility study" pptx
Báo cáo y học: "The paediatric flat foot proforma (p-FFP): improved and abridged following a reproducibility study" pptx
... common age of presentation, parental concern and clinical quandary regarding management [36]. The paediatric flat foot proforma (p-FFP) provides a prag- matic standard by which paediatric flat feet ... collection. All authors participated in protocol development and read and approved the manuscript. References 1. Sullivan JA: Pediatric flatfoot: evaluation and management...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "he paediatric flat foot and general anthropometry in 140 Australian school children aged 7 - 10 years" ppsx
... No Evans Journal of Foot and Ankle Research 2011, 4:12 http://www.jfootankleres.com/content/4/1/12 Page 6 of 7 JOURNAL OF FOOT AND ANKLE RESEARCH The paediatric flat foot and general anthropometry ... clear dis- parity, but this war rants further inquiry. Othe r unidenti- fied variables may also be proponents of altered foot posture in children. A standardized and ideall...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... Grønlien, and Jan Nystuen from the area of Innlandet, Unni Eskeland and Olav Østebø from the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and Trond Kibsgaard in the area of Haugesund. We want ... possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian Journal of Trauma, Resuscitation and E...
Ngày tải lên: 25/10/2012, 09:56
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc
... TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 CTAGCCTTGCTAGGACATCTTCCG HJ3 CGGAAGATGTCCATCTGTTGTAGG HJ4 Bio-AAAAAACCTACAACAGATCATGGAGCTTCT 5498 ... Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT HJ6 GTCGGATCCTCTAGAC...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
... GPVI was functional, we measured tyrosine phosphorylation of the FcR c-chain and the tyrosine kinase Syk, which is tyrosine phosphorylated and activated early after GPVI engagement. Phosphorylation ... ligand blotting as a band of 55 kDa. Additional bands of lower molecular mass are indicated. The associ- ated FcR c-chain was detected by Western blotting using a specific antibody. A...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: The proximal cis-acting elements Sp1, Sp3 and E2F regulate mouse mer gene transcription in Sertoli cells potx
... 5¢-TGTCCAAGGGT GTACATATCAACAT-3¢ (Mer,sense )and5 ¢-AGCC GAGGATGATGAACATAGAGT-3¢ (Mer,antisense), which generated a 700-bp Mer PCR product; 5¢-CG GCATTCCCTTCAAGGAGAGT-3¢ (Gas6,sense )and 5¢-CTCAACTGCCAGGACCACCAACT-3¢ ... concentration of RNA was determined by spectrophotometry at 260 nm, and its integrity was assessed by agarose gel electrophoresis. Polyadenylated RNA was prepared by oli...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo y học: "The tandem CCCH zinc finger protein tristetraprolin and its relevance to cytokine mRNA turnover and arthritis" pot
... UAUUUAUAUAUUUAUAUUUUUAAAAUAUUUAUUUAUUUAUUUAUUUAAGUUCAUAUUCCA HORSE UAUUUAUAUAUUUAUGUAUUUUAA-UAUUUAUUUAUUUAUUUAUUUAAGCUCAUACUCCA MOUSE UAUUUAUAUAUUUAUAUUUUUUAAAUAUUUAUUUAUUUAUUUAUUUAA WOODCHUCK UAUUUAUAUAUUUAUACUUUUAAAAUAUUUAUUUAUUUAUUUAUUG COW ... UAUUUAUAUAUUUAUACUUUUAAAAUAUUUAUUUAUUUAUUUAUUG COW UAUUUAUAUAUUUAUGUAUUUUAA-UAUUUAUUUAUUUAUUUAUUUAAACUCAUACCCCA DOG UAUUUAUAUAUUUAUGUAUUUUAA-UAUUU...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: "The 5th annual European League Against Rheumatism congress in Berlin: a personal perspective" ppsx
... the education program coordinator and accountant. One must admire the efficiency of this secretariat and congratulate EULAR on having such an able managing team. After 20 years in a small office, ... EULAR journal Annals of the Rheumatic Diseases, and also access to all educational events, unlike the American College of Rheumatology (ACR), which charges extra for these benefits. The b...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx
... CA, USA) and anion exchange chromatography on DEAE Sepha- rose (Pharmacia, Uppsala, Sweden) essentially as described [27]. Endotoxin content was determined by the lympholytic amoebocyte lysate ... response against hnRNP -A2 in patients with RA [27]. We observed that approximately half of the RA patients harbor T cells against hnRNP -A2 . In accordance with the perception of RA as an inflamm...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "The proinflammatory cytokines IL-2, IL-15 and IL-21 modulate the repertoire of mature human natural killer cell receptors" pot
... for 5 and 7 days. On days 5 and 7, cells were stained with several conjugated antibodies (see 'Cell staining for flow cytometry', above) and six-colour analysis by flow cytometry was performed ... cytotoxicity assay. To test cytotoxicity, a standard 51 Cr- release assay was performed. K562 cells were incubated for 1 hour with Na 2 51 CrO 4 (Hartmann Analytics, Braunschwei...
Ngày tải lên: 09/08/2014, 10:22