Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...

Ngày tải lên: 10/08/2014, 21:23

... increased than nor- mal latency of a and b waves (melancholic patient) All recordings are within normal range. Annals of General Psychiatry 2005, 4:7 http://www.annals-general-psychiatry.com/content/4/1/7 Page ... imped- ance was <4 kohms. All patients came from North Greece (Latitude 40–40.1° North). Statistical analysis It included Analysis of Covariance (ANCOVA) with age as a...

Ngày tải lên: 08/08/2014, 21:20

... the majority of RA patients [30]. In a randomized study patients with active RA were treated for 2 weeks with a highly specific CCR1 antagonist or placebo [29]. Synovial tissue analysis revealed a ... and other chronic inflammatory disorders. Keywords: chemokines, rheumatoid arthritis, synovial tissue 97 21. Ogata H, Takeya M, Yoshimura T, Takagi K, Takahashi K: The role of mono...

Ngày tải lên: 09/08/2014, 01:23

... pages doi:10.1155/2010/475019 Research Article A Generalized Halanay Inequality for Stability of Nonlinear Neutral Functional Differential Equations Wansheng Wang School of Mathematics and Computational Science, Changsha University ... generalized Halanay inequality proved by Baker and Tang 2, Zhang and Vandewalle 17, 18 proved the contractility and asymptotic stability of solut...

Ngày tải lên: 21/06/2014, 07:20

... W. Takahashi, Y. Takeuchi, and R. Kubota, “Strong convergence theorems by hybrid methods for families of nonexpansive mappings in Hilbert spaces,” Journal of Mathematical Analysis and Applications, ... Israel Journal of Mathematics, vol. 22, no. 1, pp. 81–86, 1975. 7 S. Reich, “Weak convergence theorems for nonexpansive mappings in Banach spaces,” Journal of Mathematical Analys...

Ngày tải lên: 21/06/2014, 11:20

... Kinderlehrer and G. Stampacchia, An Introduction to Variational Inequalities and Their Applications, vol. 88 of Pure and Applied Mathematics, Academic Press, New York, NY, USA, 1980. 10 I. Yamada, “The ... C. Wong, and J. C. Yao, “Convergence analysis of modified hybrid steepest-descent methods with variable parameters for variational inequalities,” Journal of Optimization Theory and...

Ngày tải lên: 21/06/2014, 11:20

... interval 0, 1 from the Cauchy data pairs g,h located at x  1. Of course, since g and h are assumed to be measured, there must be measurement errors, and we would actually have noisy data function ... depend continuously on the boundary data, and small errors in the boundary data can amplify the numerical solution infinitely; hence it is impossible to solve Cauchy problem of Helmholtz...

Ngày tải lên: 21/06/2014, 16:20

... 2008, Article ID 720371, 15 pages, 2008. 10 K. Aoyama, Y. Kimura, W. Takahashi, and M. Toyoda, “Approximation of common fixed points of a countable family of nonexpansive mappings in a Banach space,” ... pp. 877–898, 1976. 8 S. Adly, “Perturbed algorithms and sensitivity analysis for a general class of variational inclusions,” Journal of Mathematical Analysis and Applica...

Ngày tải lên: 21/06/2014, 20:20

... of Mathematical Analysis and Applications, vol. 241, no. 1, pp. 46–55, 2000. 2 H. K. Xu, “Viscosity approximation methods for nonexpansive mappings,” Journal of Mathematical Analysis and Applications, ... Journal of Inequalities and Applications Recall that a mapping S : C → C is called nonexpansive if Sx − Sy≤x − y for all x, y ∈ C. The set of all fixed points of S is...

Ngày tải lên: 22/06/2014, 02:20

... of Mathematics, Tianjin Polytechinc University, Tianjin 300160, China; Department of Mathematics, Shijiazhuang University, Shijiazhuang 050035, China Email address: meijuanshang@yahoo.com.cn Yongfu ... strongly monotone variational inequalities and studied the approximation solvability of this system based on a system of projection methods. Chang et al. [3] also introduced a new s...

Ngày tải lên: 22/06/2014, 18:20