Báo cáo y học: "Effect of a structurally modified human granulocyte colony stimulating factor, G-CSFa, on leukopenia in mice and monkeys" docx

... of a structurally modified human granulocyte colony stimulating factor, G-CSFa, on leukopenia in mice and monkeys Yongping Jiang 1 , Wenhong Jiang 1 , Yuchang Qiu 1 and Wei Dai 2* Abstract Background: ... protein purification experiments and was involved in data acquisition, analysis and interpretation. WJ conducted in vitro experiments including protei...

Ngày tải lên: 10/08/2014, 21:23

... (RA) is a chronic inflammatory disease that affects nearly 1% of the population worldwide and can lead to significantly impaired quality of life. Mortality rates are also significantly increased ... that DHMEQ inhibits TNF-α-induced nuclear translo- cation of NF-κB, and does not inhibit phosphorylation and degradation of IκB, or a c-Jun N-terminal kinase (JNK) and a casp...

Ngày tải lên: 09/08/2014, 07:20

... and PCV. Transpulmonary pressure, pulmonary gas exchange, and pulmonary shunt All ventilatory parameters, PaO 2 and PaCO 2 , and calculated pulmonary shunt fraction data are presented in Table ... recommendations of the Report of the Amer- ican Veterinary Medicine Association Panel on Euthanasia) Table 1 Ventilatory parameters, hemodynamics, and blood gas analysis before a...

Ngày tải lên: 12/08/2014, 23:24

... and PCV. Transpulmonary pressure, pulmonary gas exchange, and pulmonary shunt All ventilatory parameters, PaO 2 and PaCO 2 , and calculated pulmonary shunt fraction data are presented in Table ... recommendations of the Report of the Amer- ican Veterinary Medicine Association Panel on Euthanasia) Table 1 Ventilatory parameters, hemodynamics, and blood gas analysis before a...

Ngày tải lên: 12/08/2014, 23:24

... USA). Plasma and cell-associated viral load as well as SIV-RNA, total SIV-DNA and 2LTR SIV-DNA were compared in placebo and HAART-treate d macaques using a nonpara- metric Mann-Whitney test. ... vaginal transmission of the same virus, probably because of initial viral compartmentali- zation and low dissemination [29] in association with good diffusion of NRTI in the fema...

Ngày tải lên: 13/08/2014, 01:20

... was approved by the institutional review board of our hospital and informed consent was obtained in accordance with Italian national regulations. Interface The helmet (Castar, Starmed, Modena, ... humidifying capability of the respiratory tract may also be influenced by the presence of airway or pulmonary disease [26-28]. The aim of this study, conducted in patients with acute r...

Ngày tải lên: 13/08/2014, 10:20

... to CRF 2 receptors. A combination of an aromatic with a heteroaromatic ring at the N-terminus increases the binding affinity of antisauvagine-30 analogs to CRF 2 but also CRF 1 receptors. At high concentration ... noteworthy that the N-terminal amino acid D -Phe in antisauvagine-30 can be replaced by a phenyldiazirine, L -Tyr or D -Tyr [37] residue without diminishing the binding a...

Ngày tải lên: 31/03/2014, 08:20

... main- tenance of response is of utmost importance. A copy preparation, consisting of the alpha crystal form of imatinib, has become commercially available under the name ‘imatib’ (CIPLA-India) at a markedly ... performed. In May 2007, the patient resumed imatinib at a daily dose of 600 mg per day. In July 2007, after approximately two months of therapy with imatinib, lab...

Ngày tải lên: 11/08/2014, 17:21

... the in vivo and cellular assays and analysis and interpretation of data, EJM, MW and CL participated in the design of the study and analysis and interpretation of data. HB conceived of the study, participated ... sense ATAGGATCCTGCTAAGACTCCCCACCGTAA 2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT 3 Negative sense RNA-specific cDNA...

Ngày tải lên: 12/08/2014, 01:22

... super syringe technique. Variables were expressed as mean ± standard deviation. A two-way analysis of variance (ANOVA) for repeated measures was conducted to study the effects of time and PV measure- ment ... PV CF . Conclusion Evaluation of the effects of a strategy aimed at improving oxygenation can be reliably recorded early after a single PV measurement that is not followe...

Ngày tải lên: 12/08/2014, 23:23