Candida infections detection and epidemiology - part 5 pot

Candida infections detection and epidemiology - part 5 pot

Candida infections detection and epidemiology - part 5 pot

... glabrata - - - - - - - - - - lusitaniae - - - - - - - - - - krusei - - - - - - - - - - tropicalis - - - - + /- - - - - + albicans - + - - - + - - - - yeast/fungi - + + + + + + - + + AN: ... pos. neg. neg. neg. neg. pos. neg. neg. albica...

Ngày tải lên: 10/08/2014, 16:22

15 272 0
Candida infections detection and epidemiology - part 8 potx

Candida infections detection and epidemiology - part 8 potx

... 100 95 90 85 80 75 70 65 60 55 16A107 16A232 15A020 15A237 10A343 11A384 16E014 16A 551 16E026 17A381 12E070 12E036 10A139 12A103 11A182 18E014 23D046 16E033 18A220 16C067 15A 257 13A1 45 15A093 10A138 11C034 06A267 19A298 16E 050 15A3 75 15E106 16A308 06A063 15A629 15A647 19A 355 15A206 15A561 17A184 11A301 16C088 19A260 20C108 20C147 01A120 20C110 07C073 08A240 07C060 07A52...

Ngày tải lên: 10/08/2014, 16:22

15 304 0
Candida infections detection and epidemiology - part 1 pps

Candida infections detection and epidemiology - part 1 pps

... Infect. Dis. (2001), 39: 15 5- 1 60 35 IV: Clinical evaluation of a NASBA-based assay for detection of Candida spp. in blood and blood cultures Clin. Lab. (2002) In press 45 V: The Basic Kit amplification ... high as 38%, and crude mortality rates exceed 50 % 15, 29,44, 45 . The most commonly used detection method for Candida infections, automated blood culture,...

Ngày tải lên: 10/08/2014, 16:22

15 266 0
Candida infections detection and epidemiology - part 2 docx

Candida infections detection and epidemiology - part 2 docx

... used for NASBA and hybridization analysis. Position a 5& apos;-label sequence (5& apos; to 3') name description 5 5- 7 6 - ATGTCTAAGTATAAGCAATTTA p2.1 forward NASBA primer 27 1-2 53 - AATTCTAATACGACTCACTATAGGGAG- ... tropicalis, Candida albicans, Candida glabrata, and Candida lusitaniae. Using rRNA dilutions obtained from pure cultures of C. albicans, the com...

Ngày tải lên: 10/08/2014, 16:22

15 261 0
Candida infections detection and epidemiology - part 4 pdf

Candida infections detection and epidemiology - part 4 pdf

... 1c - 2176 - 1d - - - 3a - - - 3b - - - 5a - - - 5b - 1913 + 2176 - 10 1a - 2176 2176 1b - 2176 1913 1c - - 1913 1d - - - 3a (Staphylococcus epidermidis) 1913 - 3b (Staphylococcus ... 1d Candida albicans - n.d. 3a - - - 3b (Enterococcus faecalis) - - 5a (Entero...

Ngày tải lên: 10/08/2014, 16:22

15 316 0
Candida infections detection and epidemiology - part 7 doc

Candida infections detection and epidemiology - part 7 doc

... 94 ratio between 1.26 and 1 .50 ; ++ = ratio between 1 .51 and 1. 75; +++ = ratio between 1.76 and 2.00; ++++ = ratio between 2.01 and 2. 25. Proteinase assay. YCB-BSA plates (1 .5% agar; 1.17% Yeast ... reference strains and clinical isolates (see also Table 1) 10 0 90 80 70 60 50 40 30 20 10 CBS562 CBS1912 CBS19 05 A TCC9002 8 10A173 07C069 19A568 06A309 04A080 08E 058 19...

Ngày tải lên: 10/08/2014, 16:22

15 370 0
Candida infections detection and epidemiology - part 9 pps

Candida infections detection and epidemiology - part 9 pps

... Microbiol. Infect. Dis. 39: 15 5- 1 60 5. Borst, A., J. Verhoef, E. Boel, and A.C. Fluit. 2002. Clinical evaluation of a NASBA-based assay for detection of Candida spp. in blood and blood cultures. Clin. ... Sequence-Based Amplification (NASBA™) 6 and Amplified Fragment Length Polymorphism analysis (AFLP™) 35 . D ETECTION OF CANDIDA INFECTIONS The current routin...

Ngày tải lên: 10/08/2014, 16:22

15 279 0
Candida infections detection and epidemiology - part 10 docx

Candida infections detection and epidemiology - part 10 docx

... cultures in patients with candidaemia. Eur. J. Clin. Microbiol. Infect. Dis. 19: 80 3-8 05 5. Borst, A., M.A. Leverstein-Van Hall, J. Verhoef, and A.C. Fluit. 2001. Detection of Candida spp. in blood ... acid sequence-based amplification (NASBA) detection of medically important Candida species. J. Microbiol. Methods 38: 8 1-9 0 4. Borst, A., M. Leverstein-Van Hall, J. V...

Ngày tải lên: 10/08/2014, 16:22

10 238 0
Thermodynamics Interaction Studies Solids, Liquids and Gases Part 5 potx

Thermodynamics Interaction Studies Solids, Liquids and Gases Part 5 potx

... R.L. and Hirs, G.G. (1999). Thermodynamic Optimization of a Heat Exchanger. International Journal of Heat and Mass Transfer, Vol. 42, pp. ( 95 1-9 59 ). Ebadi, M.J. and Gorji-Bandpy, M. (20 05) . ... Goodarzian, H. and Biglari M. (2010). The Cost-effective Analysis of a Gas Power Plant. Taylor&Francis Group, LLC, Vol. 5, No. 4, pp. (34 8-3 58 ). Gorji-Bandpy, M.; Yahya...

Ngày tải lên: 19/06/2014, 08:20

60 351 0
Expert Systems for Human Materials and Automation Part 5 pot

Expert Systems for Human Materials and Automation Part 5 pot

... House Inc. 2004, ISBN 1 -5 8 05 3 -5 3 6-4 . [24] E. Udd, “An Overview of Fiber-Optic Sensors,” Review of Scientific Instruments, Vol. 66 Issue 8, pp. 401 5- 5 030, August 19 95. [ 25] J.F. Tressler, S. ... (http://www.engadget.com/2008/01/17/prosthetic-limbed-runner-disqualified- from-olympics/), Retrieved on 26 April 2011. [3] W. French Anderson, “Human Gene Therapy,” Science, Vol...

Ngày tải lên: 19/06/2014, 10:20

30 395 0
Từ khóa:
w