Candida infections detection and epidemiology - part 2 docx

Candida infections detection and epidemiology - part 2 docx

Candida infections detection and epidemiology - part 2 docx

... promising methods for the rapid detection of fungemia. Several groups have shown the feasibility of PCR for the detection of candidemia 6,7,1 0-1 2, 14,17 ,20 ,22 ,23 ,25 ,26 ,28 , 32 . However, sample volumes ... 22 7 -2 44 biotin CCCTCGGGCCTTTTGATG 95.66 C. krusei probe 18 0 -2 03 biotin ATCTCGACCTCTTGGAAGAGATGT 19 12 C. glabrata probe 18 0 -2 03 biotin AGCCCGACCTCTGGAAGGGC...
Ngày tải lên : 10/08/2014, 16:22
  • 15
  • 261
  • 0
Candida infections detection and epidemiology - part 10 docx

Candida infections detection and epidemiology - part 10 docx

... cultures in patients with candidaemia. Eur. J. Clin. Microbiol. Infect. Dis. 19: 80 3-8 05 5. Borst, A., M.A. Leverstein-Van Hall, J. Verhoef, and A.C. Fluit. 20 01. Detection of Candida spp. in blood ... NASBA-based assay for detection of Candida spp. in blood and blood cultures. Clin. Lab. (In press) 7. Borst, A., A.T.A. Box, and A.C. Fluit. 20 02. False-positive re...
Ngày tải lên : 10/08/2014, 16:22
  • 10
  • 238
  • 0
Candida infections detection and epidemiology - part 1 pps

Candida infections detection and epidemiology - part 1 pps

... Pinzcowski, and S. Vartivarian. 1997. The epidemiology of hematogenous candidiasis caused by different Candida species. Clin. Infect. Dis. 24 : 1 12 2- 1 128 2. Azumi, M. and N. Goto-Yamamoto. 20 01. AFLP ... evaluation of a NASBA-based assay for detection of Candida spp. in blood and blood cultures Clin. Lab. (20 02) In press 45 V: The Basic Kit amplification module f...
Ngày tải lên : 10/08/2014, 16:22
  • 15
  • 266
  • 0
Candida infections detection and epidemiology - part 4 pdf

Candida infections detection and epidemiology - part 4 pdf

... 1913 - 7 1a Candida albicans - 1913 3 1b - - - 3 1c - 21 76 - 1d - - - 3a - - - 3b - - - 5a - - - 5b - 1913 + 21 76 - 10 1a - 21 76 21 76 1b - 21 76 1913 1c - - 1913 1d - - - ... 9 14 19 1 b 4 2 4 6 2 1 1 - - - - 1 4 - - 3...
Ngày tải lên : 10/08/2014, 16:22
  • 15
  • 316
  • 0
Candida infections detection and epidemiology - part 5 pot

Candida infections detection and epidemiology - part 5 pot

... glabrata - - - - - - - - - - lusitaniae - - - - - - - - - - krusei - - - - - - - - - - tropicalis - - - - + /- - - - - + albicans - + - - - + - - - - yeast/fungi - + + + + + + - + + AN: ... anaerobic - + /- - - - - +...
Ngày tải lên : 10/08/2014, 16:22
  • 15
  • 272
  • 0
Candida infections detection and epidemiology - part 7 doc

Candida infections detection and epidemiology - part 7 doc

... Source - + /- + ++ +++ ++++ Total blood 38 (29 ) 10 (8) 36 (27 ) 22 (17) 19 (15) 6 (5) 131 (100) pneumonia 3 (13) 1 (4) 5 (22 ) 8 (35) 5 (22 ) 1 (4) 23 (100) urinary tract 7 (28 ) 2 (8) 9 (36) 3 ( 12) ... 0 90 80 70 60 50 40 30 20 10 CBS5 62 CBS19 12 CBS1905 A TCC90 02 8 10A173 07C069 19A568 06A309 04A080 08E058 19A567 23 D045 19A519 TY 727 TY 728 A TCC90 02 9 TY7 32...
Ngày tải lên : 10/08/2014, 16:22
  • 15
  • 370
  • 0
Candida infections detection and epidemiology - part 8 potx

Candida infections detection and epidemiology - part 8 potx

... P 2 : PL 2 : 100 95 90 85 80 75 70 65 60 55 16A107 16A2 32 15A 020 15A237 10A343 11A384 16E014 16A551 16E 026 17A381 12E070 12E036 10A139 12A103 11A1 82 18E014 23 D046 16E033 18A 220 16C067 15A257 13A145 15A093 10A138 11C034 06A267 19A298 16E050 15A375 15E106 16A308 06A063 15A 629 15A647 19A355 15A206 15A561 17A184 11A301 16C088 19A260 20 C108 20 C147 01A 120 20 C110 07C073 08A...
Ngày tải lên : 10/08/2014, 16:22
  • 15
  • 304
  • 0
Candida infections detection and epidemiology - part 9 pps

Candida infections detection and epidemiology - part 9 pps

... 151 8-1 529 25 . Rand, K.H., H. Houck, and M. Wolff. 1994. Detection of candidemia by polymerase chain reaction. Mol. Cell Probes. 8: 21 5 -2 21 26 . Reisner, B.S. and G.L. Woods. 1999. Times to detection ... suspected candidaemia and patients under treatment for candidaemia might be valuable. Chapters 2, 3 and 4 describe the development of a NASBA assay for the detec...
Ngày tải lên : 10/08/2014, 16:22
  • 15
  • 279
  • 0
Tài liệu A resource for reading and words part 2 docx

Tài liệu A resource for reading and words part 2 docx

... snatched the gun from the man's hands, and with his right he gave him a blow to the ear. 5. It took four visits to the clinic her phobia once and for all and to allow her to lead the happy, ... men and women were. D) whether men were attracted by a beautiful woman. E) if ice-was painful. READING COMPREHENSION 1. We understand that the area mentioned in the passage A...
Ngày tải lên : 23/12/2013, 11:15
  • 15
  • 850
  • 1