báo cáo khoa học: " A Guide for applying a revised version of the PARIHS framework for implementation" pdf
báo cáo khoa học: " A Guide for applying a revised version of the PARIHS framework for implementation" pdf
... general nature and intent of the PARIHS framework. • Basic expectations for applying any framework, the- ory, or model were a guiding influence, that is, the need for clear conceptual and operational definitions, ... et al.: A Guide for applying a revised version of the PARIHS framework for implementation. Implementation Science 2011 6:99. Submit y...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo khoa học: "Treatment planning using MRI data: an analysis of the dose calculation accuracy for different treatment regions" ppt
... phantom provided by the vendor for each available CT tube vol- tage. The HU homogeneity was verified us ing a CAT- PHAN 600 phantom (The Phantom Laboratory, Salem, NY, USA), and the peripheral HU value varied ... standard CT geometry. The mean MU values of the bulk density assigned plans were within 1% of the CT plans for all patient groups. There was a consistent imp...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Cationized gelatin-HVJ envelope with sodium borocaptate improved the BNCT efficacy for liver tumors in vivo" pptx
... Nakagawa K, Takahashi H, Nakazawa M, Eriguchi M: Evaluation of neutron dosimetry on pancreatic cancer phantom model for application of intraoperative boron neutron-capture therapy. Biomed Pharmacother ... (MEXT). Author details 1 Department of Surgery, Osaka University Graduate School of Medicine, Osaka, Japan. 2 Medical Center for Translational Research, Osaka University Hospital...
Ngày tải lên: 09/08/2014, 09:20
Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx
... cDNA coding for human p2 5a and primers 5¢-CACTCTAGAC- CATGGCTGCATCCCCTGAGCTCAGT-3¢ and 5¢-CAC- GGATCCCTACTTGCCCCCTTGCAC-3¢ for P25aDN, and 5¢-CACTCTAGACCATGGCTGACAAGG-3¢ and 5¢-CACGGATCCCTACGTCACCCCTGA-3¢ ... was amplified and tagged with six histidine residues by PCR using for- ward primers 5¢-CACCATCACGGAGCATCCCCTGAG- 3¢,5¢-TCGCATCACCATCACCATCACGGAGCA-3¢ and 5¢-CACCCATGGGATCGCATCACCA...
Ngày tải lên: 14/02/2014, 21:20
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf
... zinc-bound Ab and soluble copper-bound GIF [38]. Therefore, the metal swap led to simultaneous modification of the final form of Ab(1–40) and suggests that it caused the de-aggregation of Ab. In a therapeutic ... the levels of GIF are altered dramatically in the neurode- generative or traumatically injured brain. The best- characterized example of this is for AD. Indee...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx
... immunoreactive Grb14 was examined using preparative and analytical fractionation and compared to that of the IR. Upon differential centrifugation (Fig. 1A) , Grb14 was detect- able as a major protein of 60 kDa in ... Incorporated (Lake Placid, NY, USA). Monoclonal antibody against EEA1 (clone 14) was from BD Transduction Laboratories (San Jose, CA, USA). Monoclonal antibody against Na...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... that the maximum stability and activity of the AAP occurs in the pH range 8.0–8.5 [23]. When evaluating the influence of Table 2. Thermodynamic parameters of the thermal denaturaturation of the different ... Nitta, K., Kawauchi, H., Takayanagi, Y. & Oyama, F. (1991) Comparative base specificity, stability, and lectin activity of two lectins from eggs of Rana catesbeia...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... p Bottom O1 O2 O2 cl O3 O2 cro O1 O1 +–– –140 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA AGTAGGTTTTGTAAGCGGGAGGTGACAACATG TCATCCAAAACATTCGCCCTCCACTGTTGTAC ... AAACCTACTATACACGATACGTGTA CTTGAGTCA Sy...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... However, the position of the samples in Fig. 4A is influenced by the level of all variables in these samples. For example, the samples of the strains in the third quadrant of Fig. 4A have a tendency ... proton upon the uptake of a nitrate ion. The added titrant in the stationary phase of both ammonium and nitrate cul- tures was NaOH, which was caused by eq...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: "Finding Deceptive Opinion Spam by Any Stretch of the Imagination" pptx
... via Mechanical Turk Crowdsourcing services such as AMT have made large-scale data annotation and collection efforts fi- nancially affordable by granting anyone with ba- sic programming skills access ... restrict our task to Turkers who are located in the United States, and who maintain an approval rating of at least 90%. Turkers are allowed a maximum of 30 minutes to work on the HIT,...
Ngày tải lên: 07/03/2014, 22:20