báo cáo khoa học: "care management: A decision-makerresearcher partnership systematic review of effects on process of care and patient outcomes" docx

... 5 Research Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit Rob Shulman 1 , Mervyn Singer 2 , John Goldstone 3 and ... critically revising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis, interpretation an...

Ngày tải lên: 25/10/2012, 10:39

... similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealing because of the presence of a putative nucleotide-bind- ing motif in the N-terminal of the protein sequence and ... to seek accu- mulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily...

Ngày tải lên: 15/02/2014, 01:20

... MINIREVIEW Multifunctional host defense peptides: Antimicrobial peptides, the small yet big players in innate and adaptive immunity Constance Auvynet 1,2, * and Yvonne Rosenstein 1 1 Instituto de Biotecnologia, ... [13]. Cathelicidins kill Gram-positive and Gram-negative bacteria and Trypanosoma cruzi. Similar to defensins, cathelicidins participate activ...

Ngày tải lên: 18/02/2014, 06:20

... gagt … ccac ag GGATGT 1.4 3 105 a TAACAG gt aata … ttcc ag ACGTAT 6.5 4 250 TATCTG gt atgt … taac ag GATATG 0.89 5 120 ACGGAG gt aaaa … tccc ag CAACTC 1.7 6 138 GTTTTG gt aaga … attt ag GGCAGT 0.52 7 117 ... 7.7 4 262 a TACTTG gt atgt … aatc ag GATATG 1.3 5 120 a ACAGAG gt aaaa … tctc ag AAAATT 9.9 6 138 GCATTG gt aagg … attt ag GGCAGT 1.2 7 117 CATTAT gt aagt … tttc ag GATATT 0.17 8 16...

Ngày tải lên: 23/03/2014, 13:20

... group’ interviews at farmer association (aqua club) meetings using similar questions as 1 A PRELIMINARY EVALUATION OF ADOPTION AND IMPLEMENTATION OF BETTER MANAGEMENT PRACTICES IN THE CATFISH ... within the catfish farming sector in the Mekong Delta ã Improved performance of BMPs in addressing social and environmental issues and overall su...

Ngày tải lên: 21/06/2014, 04:20

... faults respectively, it has been shown that the gear fault diagnosis approach based on IMF AR model and SVM can be applied to classify the gear working conditions and fault patterns effectively and accurately even ... AR model can only be applied to stationary signals, while the gear fault vibration signals always display nonstationary behavior. To target this pro...

Ngày tải lên: 21/06/2014, 22:20

... formatted PDF and full text (HTML) versions will be made available soon. The management of advanced oral cancer in a Jehovah's Witness using the Ultracision Harmonic Scalpel World Journal of ... dose of 1 gram tranexamic acid and anaestethseia was induced with a combination of propofol (120mg), fentanyl (100mcg) and vecuronium (8mg). Anaesthesia was ma...

Ngày tải lên: 09/08/2014, 02:21

... W Open Access Computerized clinical decision support systems for primary preventive care: A decision- maker- researcher partnership systematic review of effects on process of care and patient outcomes Nathan ... clinical decis ion support systems for primary preventive care: A decision- maker-researcher partnership systematic re...

Ngày tải lên: 10/08/2014, 11:20

... for acute care; used an randomized controlled trial (RCT) design where patient care with a CCDSS was compared to patient care without a CCDSS; assessed effects among healthcare professionals in ... clinic al decision support systems for acute care management: A decision-maker-researcher partnership systematic review of effects on process of care and p...

Ngày tải lên: 10/08/2014, 11:20

... 13(2):106-111. doi:10.1186/1748-5908-6-100 Cite this article as: Fernandez et al.: The counseling african americans to control hypertension (caatch) trial: baseline demographic, clinical, psychosocial, and behavioral characteristics. ... americans to control hypertension (caatch) trial: baseline demographic, clinical, psychosocial, and be...

Ngày tải lên: 10/08/2014, 11:20

... presence of an abdominal bruit. Diagnosis, therefore, is often incidental or delayed. Case presentation: We report a case of a spontaneous ilio-iliac arteriovenous fistula in a 68-year-old Caucasian man ... Zenia Martin, Naseem Haider, Mary P Colgan, Dermot Moore, Prakash Madhavan and Sean M O’Neill Abstract Introduction: Spontaneous iliac arteriovenous fistulae are a...

Ngày tải lên: 10/08/2014, 23:20

... Access Successful management of refractory pleural effusion due to systemic immunoglobulin light chain amyloidosis by vincristine adriamycin dexamethasone chemotherapy: a case report Toshikazu Araoka 1 , ... use of vincristine, adriamycin and dexamethasone chemotherapy for refractory pleural effusion due to systemic immunoglobulin...

Ngày tải lên: 11/08/2014, 02:21

... available data and its precise relationship to the clinical areas of interest. The routine use of educational outreach visiting by exist- ing pharmaceutical advisers, untargeted, may not be a worthwhile ... pre- scribed within a pragmatic evaluation of educational out- reach visiting by pharmacy advisers in a service setting. Table 1: Practice characteristics: nu...

Ngày tải lên: 11/08/2014, 05:22

... treatment of TMDs, occlusal equilibration was performed for a patient with aural symptoms (otalgia, tinnitus and vertigo) of unknown etiology in the right ear. An occlusal analysis was performed ... report Occlusal management for a patient with aural symptoms of unknown etiology: a case report Kengo Torii* 1 and Ichiro Chiwata 2 Address: 1 Tor...

Ngày tải lên: 11/08/2014, 10:22

... CA). Gene specific primers with flanking attB sites were used to amplify the gene (5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACAA TGGCGGCGGATGCTCTGAG3' and 5'GGGGACCACTTT- GTACAAGAAAGCTGGGTCAGCAGCAACTTCTTCTTGAT CCTTG3'). ... inserts (5'AAAAACAAAAGCAGACATCGAC3' for sco1-2, 5'GACCAAACAAAATCACAATAAG3' for sco1-3, and 5'ATGAAACACGAGCTATATTGAG3' for sco1-4...

Ngày tải lên: 12/08/2014, 05:20