0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Towards successful coordination of electronic health record based-referrals: a qualitative analysis" pot

Tài liệu Báo cáo khoa học

Tài liệu Báo cáo khoa học " Towards Better Evaluation of Design Wind Speed of Vietnam " doc

... and S.T. Adcock S.T, A review of methods to calculate extreme wind speeds”, Met. App. 6, 119-132, 1999. Towards Better Evaluation of Design Wind Speed of Vietnam Le Truong Giang PhD ... evaluating design wind speed of Vietnam. Moreover, discussion on uncertainties in developing wind map of Vietnam and future works are also provided. 2. Choosing and processing wind data of Vietnam ... maximum wind speed; Pcom(…) and Pi(…) are respectively cumulative combined probability of maximum wind and cumulative probability of maximum wind of wind mechanism i ; u is wind speed...
  • 12
  • 574
  • 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

... to Ala eliminated activity in binding to a BPA molecule, and individual mutations drasticallyreduced the activity. Because Ala lacks the character-istic side chains of Glu and Arg, the mutant ... Glu275Ala, cgg for Glu275Arg, gac for Glu275Asp, and ctg for Glu275Leu);5Â-TCCTTGGTGTCGTATACxxxTCTCTTTCA-3Â (xxx ẳgcg for Arg316 fi Ala, aag for Arg316 fi Lys, ctg for Arg316 fi Leu, and gag for Arg316 ... The Authors Journal compilation ê 2007 FEBS 6341 Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c Chief and corroborative...
  • 12
  • 583
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx

... the class of the majority of the items which reached it during training. The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance. Using the Gini ... for the LPE experiments because of the ceiling effect and the small size of the complete data set, therefore, we did not rerun the corresponding experiments. Furthermore, the number of codebook ... from the domains of law and economy contain more VAINF than others. The potential meaning of common punctuation marks is quite clear: the longer the sentences an author constructs, the fewer...
  • 8
  • 689
  • 1
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... MINIREVIEW Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action Jamal Tazi1, Nadia Bakkour1, Virginie Marchand2, Lilia Ayadi2, Amina Aboufirassi1and ChristianeBranlant21 ... 32]ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al.872 FEBS Journal 277 (2010) ... hnRNP A1 CUAGACUAGA 5428–5437ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 ,hnRNP E1 ⁄ E2AGAUCCAUUCGAUUAGunknown8047–8062...
  • 10
  • 434
  • 0
Báo cáo khoa học: Site specificity of yeast histone acetyltransferase B complex in vivo pot

Báo cáo khoa học: Site specificity of yeast histone acetyltransferase B complex in vivo pot

... bonafide target for acetylation by the yeast < /b> HAT -B complex in vivo. Remarkably, the inability of < /b> the HAT -B complex to acetylate histone < /b> H4 containing the K12Rsubstitution, both in vivo and in ... containing Hat1 as a catalyticsubunit have been described in yeast < /b> [20,24,33],although the presence of < /b> histones in all of < /b> them hasnot been analyzed. In any case, the absence of < /b> his-tone H3 in ... dispensable for this pro-cess. In yeast,< /b> the substitution mutation of < /b> Lys5 andLys12 of < /b> histone < /b> H4, in combination with deletion of< /b> the histone < /b> H3 N-terminus, does not result in defectivechromatin...
  • 15
  • 385
  • 0
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

... 2007 FEBS 1611 Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression Attila L. Ne´meth1,*, Pe´ter ... above-mentioned ATG codon. Isolation and chemical identification of trypsinogen 4 from human brainDifferent antihuman trypsinogen 4 mAbs were raisedseparately against recombinant human trypsin 4 (mAb 1 ... that the translated form mayhave used a CUG start codon with an N-terminal leu-cine amino acid. Our present study indicates that non-AUG translation initiation may be operable moreoften than...
  • 11
  • 469
  • 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx

Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx

... pre-paration of a catalytic antibody light chain capable of specifically digestingthe b-subunit of H. pylori urease. AbbreviationsHpU-9-H, HpU-9 heavy chain; HpU-9-L, HpU-9 light chain; VIP, vasoactive ... Corporation), Saitama, Japan3 Oita University, Faculty of Medicine, Oita, JapanMany natural catalytic antibodies have been discov-ered in the last decade. The first natural catalytic anti-body ... documented that the light chain of an antibody could possess a catalytic cleavage activityagainst peptides and ⁄ or proteins [4–6,18,22]. HpU-9-Ldisplayed catalytic ability. In our cleavage assay forthe...
  • 9
  • 388
  • 0
Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx

Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx

... the two initial steps. Note thatthe curves can easily discriminate nonpolar and polar solvents. In nonpolar solvents, water is highly retainedat the enzyme surface, whereas in polar solvents, ... number of water molecules percluster. Again, the behavior in nonpolar and polar sol-vents is easily distinguishable by this property. In thepresence of nonpolar organic solvents, the number of water ... polarity of the organic solvent.Concluding remarksWe have performed a systematic simulation study of the hydration mechanism of one enzyme in three dis-tinct classes of solvent: nonpolar organic...
  • 13
  • 433
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The Benefit of Stochastic PP Attachment to a Rule-Based Parser" doc

... methods.Because probabilistic approaches solve PP at-tachment as a natural subtask of parsing anyhow,the obvious application of a PP attacher is to in-tegrate it into a rule-based system. Perhaps ... existence of learntand handwritten grammars of natural languages. A great many formalisms have been advanced thatfall into either of the two variants, but even thebest of them cannot be said to interpret ... therefore adopted his approach andartificially inflated all noun+preposition counts by a constant factor i. To estimate an appropriatevalue for this factor, we extracted 178 instances of the standard...
  • 8
  • 331
  • 0
Báo cáo khoa học: The crystal structure of Thermoactinomyces vulgaris R-47 a-amylase II (TVA II) complexed with transglycosylated product potx

Báo cáo khoa học: The crystal structure of Thermoactinomyces vulgaris R-47 a-amylase II (TVA II) complexed with transglycosylated product potx

... Kamitori, S.(2001) Studies on the hydrolyzing mechanism for cyclodextrins of Thermoactinomyces vulgaris R-47 a-amylase 2 (TVAII). X-ray structure of the mutant E354A complexed with b-cyclodextrin,and ... that of acarbose. In the case of 42-P2, Glc )3extends toward the space between loops II and III. The length of loop II of TVA II is very short and the cleft isopen, which enables TVA II to ... (2001) Role of Phe286 in the recognition mechanism of cyclomaltooligosaccharides (cyclodextrins) by Thermo-actinomyces vulgaris R-47 a-amylase 2 (TVAII): X-ray structures of the mutant TVAIIs, F286A...
  • 9
  • 361
  • 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx

Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx

... pathogenesis. EspB as an effector of actin filamentreorganizationThe EspB (or EarB) gene product was first identified as an important factor in EPEC attachment [14] and latercharacterized as a ... MINIREVIEW Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagic Escherichia coli: a case for EspB as an intrinsically less-ordered effector Daizo Hamada1, Mitsuhide Hamaguchi2, ... EspB- bound a- catenin showsenhanced affinity with actin filaments and also promotes bundling of actin filaments that accumulate at pedestals formed underneaththe attachment site of bacterial cell. EspB as...
  • 7
  • 333
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Towards Automatic Classification of Discourse Elements in Essays" potx

... your observations of other people. The writing in Figure 1 illustrates one kind of challenge in automatic identification of discourse elements, such as thesis statements. In this case, the ... purposes of comparison, Table 2 also shows the performance of two baselines: the random baseline classifies the thesis statements Towards Automatic Classification of Discourse Elements in Essays ... Are the main points in my essay clearly stated? d) Do the main points in my essay relate to my original thesis statement? If these questions are expressed in general terms, they are of little...
  • 8
  • 199
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "TOWARDS THE SEMANTICS OF SINTENCE AYVERBIALS " doc

... (in the ~rimary case), or the rest of the topic (in the secondary case); the other CA expressions in the cluster have in their scopes the rest of the cluster. 78 TOWAR/S THE SEI~ANTICS OF ... dependency tree of the TR of a sentence: the relation of dependency and the relation of the deep word-order, which means that a TR captures the twofold structuring of (the meaning of) a sentence: ... Firstly, there can be generated in the focus (and in the secondary case, also in the topic) of a sentence clusters of two or more occurrences of CA, which differ in the degrees of their con~unicative...
  • 7
  • 255
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Towards genetic engineering of maritime pine (Pinus pinaster Ait." potx

... loblolly pine (Pinus taeda), Plant Mol. Biol. 39 (1999)407–416.To access this journal online:www.edpsciences.org Genetic transformation of maritime pine 697 Genetic transformation of maritime pine ... label of pollen bulk lot from selected father clones), or open pollination (X) of mother clones. J F. Trontin et al .Genetic transformation of maritime pine Original articleTowards genetic engineering ... additional months(figure 2C). Thus, our protocol of genetic transformation of maritime pine yielded transgenic plants within one year. Inthe case of cryopreserved lines, 3 more months were requiredto...
  • 12
  • 334
  • 0
báo cáo khoa học:

báo cáo khoa học: "Towards successful coordination of electronic health record based-referrals: a qualitative analysis" pot

... 6:84http://www.implementationscience.com/content/6/1/84Page 7 of 12 RESEARC H Open AccessTowards successful coordination of electronic health record based-referrals: a qualitative analysisSylvia J Hysong1,2*, Adol Esquivel3, Dean F Sittig4, ... K, Schultz E, Albin L, Pineda N, Lonhart J, Sundaram V, et al: Care Coordination Measures Atlas. Agency for Healthcare Research andQuality. 2010 [http://www.ahrq.gov/qual/careatlas/index.html], ... An IntegrativePerspective. Academy of Management Annals 2010, 3:463-502.22. Okhuysen GA, Bechky BA: Coordination in Organizations: An IntegrativePerspective. Academy of Management Annals 2009,...
  • 12
  • 217
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP