báo cáo khoa học: "Towards successful coordination of electronic health record based-referrals: a qualitative analysis" pot

... and S.T. Adcock S.T , A review of methods to calculate extreme wind speeds”, Met. App . 6, 119-132, 1999. Towards Better Evaluation of Design Wind Speed of Vietnam Le Truong Giang PhD ... evaluating design wind speed of Vietnam. Moreover, discussion on uncertainties in developing wind map of Vietnam and future works are also provided. 2. Choosi...

Ngày tải lên: 18/02/2014, 13:20

... to Ala eliminated activity in binding to a BPA molecule, and individual mutations drastically reduced the activity. Because Ala lacks the character- istic side chains of Glu and Arg, the mutant ... Glu275Ala, cgg for Glu275Arg, gac for Glu275Asp, and ctg for Glu275Leu); 5Â-TCCTTGGTGTCGTATACxxxTCTCTTTCA-3Â (xxx ẳ gcg for Arg316 fi Ala, aag for Arg316 fi Lys, ctg for Arg31...

Ngày tải lên: 18/02/2014, 16:20

... the class of the majority of the items which reached it during training. The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance. Using the Gini ... for the LPE experiments because of the ceiling effect and the small size of the complete data set, therefore, we did not rerun the corresponding experiments. Fu...

Ngày tải lên: 22/02/2014, 03:20

... MINIREVIEW Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action Jamal Tazi 1 , Nadia Bakkour 1 , Virginie Marchand 2 , Lilia Ayadi 2 , Amina Aboufirassi 1 and Christiane Branlant 2 1 ... 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splic...

Ngày tải lên: 06/03/2014, 09:22

... bona fide target for acetylation by the yeast < /b> HAT -B complex in vivo. Remarkably, the inability of < /b> the HAT -B complex to acetylate histone < /b> H4 containing the K12R substitution, both in vivo and in ... containing Hat1 as a catalytic subunit have been described in yeast < /b> [20,24,33], although the presence of < /b> histones in all of < /b> them has no...

Ngày tải lên: 07/03/2014, 05:20

... 2007 FEBS 1611 Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression Attila L. Ne ´ meth 1, *, Pe ´ ter ... above-mentioned ATG codon. Isolation and chemical identification of trypsinogen 4 from human brain Different antihuman trypsinogen 4 mA...

Ngày tải lên: 07/03/2014, 10:20

... pre- paration of a catalytic antibody light chain capable of specifically digesting the b-subunit of H. pylori urease. Abbreviations HpU-9-H, HpU-9 heavy chain; HpU-9-L, HpU-9 light chain; VIP, vasoactive ... Corporation), Saitama, Japan 3 Oita University, Faculty of Medicine, Oita, Japan Many natural catalytic antibodies have been discov- ered in the last decade....

Ngày tải lên: 07/03/2014, 21:20

... the two initial steps. Note that the curves can easily discriminate nonpolar and polar solvents. In nonpolar solvents, water is highly retained at the enzyme surface, whereas in polar solvents, ... number of water molecules per cluster. Again, the behavior in nonpolar and polar sol- vents is easily distinguishable by this property. In the presence of nonpolar...

Ngày tải lên: 16/03/2014, 10:20

... methods. Because probabilistic approaches solve PP at- tachment as a natural subtask of parsing anyhow, the obvious application of a PP attacher is to in- tegrate it into a rule-based system. Perhaps ... existence of learnt and handwritten grammars of natural languages. A great many formalisms have been advanced that fall into either of the two variants, but even the...

Ngày tải lên: 17/03/2014, 04:20

... Kamitori, S. (2001) Studies on the hydrolyzing mechanism for cyclodextrins of Thermoactinomyces vulgaris R-47 a-amylase 2 (TVAII). X-ray structure of the mutant E354A complexed with b-cyclodextrin, and ... that of acarbose. In the case of 4 2 -P2, Glc )3 extends toward the space between loops II and III. The length of loop II of TVA II is very short a...

Ngày tải lên: 23/03/2014, 12:20

... pathogenesis. EspB as an effector of actin filament reorganization The EspB (or EarB) gene product was first identified as an important factor in EPEC attachment [14] and later characterized as a ... MINIREVIEW Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagic Escherichia coli: a case for EspB as an intrinsically less-ord...

Ngày tải lên: 29/03/2014, 09:20

... your observations of other people. The writing in Figure 1 illustrates one kind of challenge in automatic identification of discourse elements, such as thesis statements. In this case, the ... purposes of comparison, Table 2 also shows the performance of two baselines: the random baseline classifies the thesis statements Towards Automatic Classification of...

Ngày tải lên: 31/03/2014, 04:20

... (in the ~rimary case), or the rest of the topic (in the secondary case); the other CA expressions in the cluster have in their scopes the rest of the cluster. 78 TOWAR/S THE SEI~ANTICS OF ... dependency tree of the TR of a sentence: the relation of dependency and the relation of the deep word-order, which means that a TR captures the twofold...

Ngày tải lên: 01/04/2014, 00:20

... loblolly pine (Pinus taeda), Plant Mol. Biol. 39 (1999) 407–416. To access this journal online: www.edpsciences.org Genetic transformation of maritime pine 697 Genetic transformation of maritime pine ... label of pollen bulk lot from selected father clones), or open pollination (X) of mother clones. J F. Trontin et al .Genetic transformation of maritime pine...

Ngày tải lên: 08/08/2014, 14:20

... 6:84 http://www.implementationscience.com/content/6/1/84 Page 7 of 12 RESEARC H Open Access Towards successful coordination of electronic health record based-referrals: a qualitative analysis Sylvia J Hysong 1,2* , Adol Esquivel 3 , Dean F Sittig 4 , ... K, Schultz E, Albin L, Pineda N, Lonhart J, Sundaram V, et al: Care Coordination Measures Atlas. Agency for Healthcar...

Ngày tải lên: 10/08/2014, 11:20