báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps

báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps

báo cáo khoa học: "E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE II" pps

... [http://www.agreetrust.org/resource-centre/ training/ ]. doi:10.1186/1748-5908-6-81 Cite this article as: Brouwers et al.: E-learning interventions are comparable to user’s manual in a randomized trial of training strategies for the AGREE ... a traditional training method using a PDF version of the User’sManualto determine their effects on various me...

Ngày tải lên: 10/08/2014, 11:20

10 439 0
báo cáo khoa học: " Diffuse large B-cell non Hodgkin’s lymphoma in a 65-year-old woman presenting with hypopituitarism and recovering after chemotherapy: a case report" pptx

báo cáo khoa học: " Diffuse large B-cell non Hodgkin’s lymphoma in a 65-year-old woman presenting with hypopituitarism and recovering after chemotherapy: a case report" pptx

... effective. Consent Written informed consent was obtained from the patient for publication of this case report and any accompany- ing images. A copy of the written consent is available for review by the Editor -in- Chief ... imaging showed no mass lesions in the pituitary although a positron emission tomography scan showed abnormal pituitary activity. An abdominal compute...

Ngày tải lên: 10/08/2014, 23:20

4 272 0
Tài liệu Báo cáo khoa học: "Which words are hard to recognize? Prosodic, lexical, and disfluency factors that increase ASR error rates" ppt

Tài liệu Báo cáo khoa học: "Which words are hard to recognize? Prosodic, lexical, and disfluency factors that increase ASR error rates" ppt

... our analysis to other ASR systems in order to determine the generality of our findings, we have already gained important insights into a number of factors that increase ASR error rates. In addition, ... the log transform of pitch range was originally based on the distribution of pitch range values in the data set. Exploratory data analysis also indicated that using...

Ngày tải lên: 20/02/2014, 09:20

9 441 0
Báo cáo khoa hoc:" Pituitary macroadenomas: are combination antiplatelet and anticoagulant therapy contraindicated? A case report" pot

Báo cáo khoa hoc:" Pituitary macroadenomas: are combination antiplatelet and anticoagulant therapy contraindicated? A case report" pot

... Circulation 2003, 108:1682-1687. 13. Kawasaki T, Azuma A, Sawada T, Sugihara H, Kuribayashi T, Satoh M, Shimizu Y, Nakagawa M: Electrocardiographic score as a predic- tor of mortality after subarachnoid ... considered a relative contraindication for anticoagulation. These patients should be warned about the potential risks of anticoagulation with respect to their pituitary aden...

Ngày tải lên: 11/08/2014, 10:22

4 238 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... GGAAGTCTCCCTTCCCAGAC CGATTTGCTGACCACCTTCT MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA ... TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense CATGGTCATGGTCAG a ERb antisense GAATGTCATAGCTGA a MLL1 antisense TGCCAGTCGTTCCTCTCCAC a MLL2 antisense ACTCTGCCACTTCCCG...

Ngày tải lên: 18/02/2014, 14:20

12 519 0
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... isopropylamine, n- butylamine, n-amylamine, n-hexylamine, 1,6-diamino- hexane, and spermidine. Interestingly, the enzyme was unable to use ammonia as a substrate and was distinct from alanine dehydrogenase ... Toyobo (Osaka, Japan), and New England Biolabs (Beverly, MA, USA). All other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industri...

Ngày tải lên: 19/02/2014, 16:20

7 518 0
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

... Stimulation of both the calmodulin kinase II and Akt kinase pathways are responsible for the upregulation of the p65 subunit of NF-jB [22]. Activation of PI3K, mitogen-activated protein kinase kinase ... ‘classic’ pathway and the ‘alternative’ pathway, which result in the release of NF-jB from its inhibitors and in the nuclear localiza- tion of NF-jB [7]. The...

Ngày tải lên: 07/03/2014, 03:20

9 527 0
Báo cáo khoa học: "Using Conditional Random Fields to Predict Pitch Accents in Conversational Speech" pptx

Báo cáo khoa học: "Using Conditional Random Fields to Predict Pitch Accents in Conversational Speech" pptx

... of pitch accent. While certainly all of these variables are not independent of on another, using CRFs, one can incorporate all of these variables into the pitch accent prediction model with the ... (6) Rather than using mutual information as a measure of collocational strength, we used unigram, bigram and joint probabilities. A model that includes both joint probability an...

Ngày tải lên: 08/03/2014, 04:22

7 541 0
Báo cáo khoa học: Immunonanoparticles ) an effective tool to impair harmful proteolysis in invasive breast tumor cells docx

Báo cáo khoa học: Immunonanoparticles ) an effective tool to impair harmful proteolysis in invasive breast tumor cells docx

... membrane proteins of MCF-7 human invasive ductal breast carcinoma. Using immuno- cytochemical analysis, its positive staining was detected predominantly in primary breast carcinomas and in meta- static ... an excessive intracellular proteolytic activ- ity of cysteine proteases, resulting in the degradation of extracellular matrix. Cysteine protease inhibitors are capable of...

Ngày tải lên: 23/03/2014, 07:20

12 318 0
Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

... or decreasing the stability of uPA mRNA and therefore impairing or favoring their degradation. As the uPA mRNA of certain human tumor cell lines is more stable than that produced by normal cells ... argues in favor of combinatorial miR target regulation, in which the translatability of uPA and c-met mRNAs may be subject to combinatorial regulation by multi- ple miRs, inclu...

Ngày tải lên: 29/03/2014, 23:20

17 288 0
w