báo cáo khoa học: "Disseminating quality improvement: study protocol for a large cluster-randomized trial" docx

... Open Access Disseminating quality improvement: study protocol for a large cluster-randomized trial Andrew R Quanbeck 1* , David H Gustafson 1 , James H Ford II 1 , Alice Pulvermacher 1 , Michael ... of the practices on clients, and give practical advice about how to implement them. The measures of management quality, readiness for organizational change, and the potential f...

Ngày tải lên: 10/08/2014, 10:23

... ( (quality ADJ3 improv$) or (quality ADJ3 enhanc$)).mp. 2 (quality of health care or quality assurance, health care or quality indicators, health care or health plan implementation).sh. 3 1 AND ... OR (lean ADJ healthcare) OR (lean ADJ health adj care) OR (lean ADJ health ADJ service) OR (lean ADJ healthcare ADJ service) OR (lean ADJ health ADJ care ADJ service)).mp. OR ((inventive ADJ...

Ngày tải lên: 10/08/2014, 11:20

... (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAase-f...

Ngày tải lên: 19/02/2014, 12:20

... the translation. The variant which is mostly used is a form of beam-search, where several partial can- didates are maintained in parallel, and candidates for which the current score is too low are ... sentence are as follows: ID source target h cette this t traduction translation ht cette traduction this translation mt traduction automatique machine translation a automatique automatic m...

Ngày tải lên: 20/02/2014, 07:20

... id='1' start='158' end='176' features='participant;human' state='active'/> <segment id='2' start='207' end='214' ... 3. An important feature of the tool is that any change to the coding scheme is automatically propagated throughout all files annotated at this layer. For instance, if a feature is...

Ngày tải lên: 20/02/2014, 09:20

... abac abcS = abacT = p r o d . 1 0 1 0 1 0 0 1 0 2 1 1 0 1 3 λ λ+ 0 λ 0 0 λ 0 ( a, b, c, ab, ac, bc, abc) ( a, b, c, aa, ab, ac, ba, bc, aba, aac, abc, bac, abac) u 3 5 3λ λ+ + k e r n e l v al ... ) 2 uχ 0.1 0.5 1.2 1 1 1 1.5 0.9 0.8 a, b, c, aa, ab, ac, ba, bc, aba, aac, abc, bac, abac abcS = abacT = p r o d . 1 0 1 0 1 0 0 1 0 2 1 1 0 1 3 λ λ+ 0 λ 0 0 λ 0 1.0τ = t h r e s h o l d 2.5 1...

Ngày tải lên: 23/03/2014, 19:20

... USA, June 2008. c 2008 Association for Computational Linguistics Dictionary Definitions based Homograph Identification using a Generative Hierarchical Model Anagha Kulkarni Jamie Callan ... Homographs in a Lexicon Our goal is to identify the homographs in a large lexicon. We assume that manual labor is a scarce resource, but that online dictionaries are plentiful (as is...

Ngày tải lên: 31/03/2014, 00:20

... Yoshida N, Kajiyama H, Shibata K, Yamamoto E, Kidokoro K, Takahashi N, Terauchi M, Nawa A, Nomura S, Nagasaka T, Takikawa O, Kikkawa F: Indoleamine 2,3-dioxygenase is a novel prognostic indicator for ... Shibata F, Aburatani I, Tsuneyama K, Sabit H, Harada K, Miyazaki K, Nakanuma Y: Up-regulation of fas ligand at early stages and down-regulation of Fas at progressed stages of intrahepati...

Ngày tải lên: 10/08/2014, 10:21

... junctions. For VvAGL11,theoligosare 5’ -GCAGAAGTTGCCCTCATCGT-3’ and 5’ -AAGC- CAAGGAATCACCCATT-3’; for the internal reference gene EF1 -a (GSVIVT00024496001-8.4x ) the oligos are 5’ -AGGATGGACAAACCCGTGAG-3’ ... isolate this region are 5’-caccTTGTGGCCTT- GAAGAAA-3’ and 5’ -CACAATGGAGAGATGTGA- GACG-3’ , and the manufacturer’ s conditions were followed for the PCR, purification and ligati...

Ngày tải lên: 11/08/2014, 11:21

... the data analyses and counted as drop- out (cut-off: answered at least 70% of the questions). Data Analysis Data will be analysed according to the intention-to-treat principle. Multiple imputations ... registered at Current Controlled Trials and is traceable as NTR-ISRCTN93702927. Background Although data on the prevalence of problematic cocaine use and addiction are lacking in Switzerland an...

Ngày tải lên: 11/08/2014, 15:22