cáo khoa học: " Fostering shared decision making by occupational therapists and workers involved in accidents resulting in persistent musculoskeletal disorders: A study protocol" ppsx
cáo khoa học: " Fostering shared decision making by occupational therapists and workers involved in accidents resulting in persistent musculoskeletal disorders: A study protocol" ppsx
... 50:211-212. doi:10.1186/1748-5908-6-22 Cite this article as: Coutu et al.: Fostering shared decision making by occupational therapists and workers involved in accidents resulting in persistent musculoskeletal disorders: A study protocol. ... 6:22 http://www.implementationscience.com/content/6/1/22 Page 4 of 8 STUD Y PRO T O C O L Open Access Fostering...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: " Translating shared decision-making into health care clinical practices: Proof of concepts" pot
... research initiative are many: International and interdisciplinary group of researchers dedicated to implementing SDM in clinical practice using a dyadic perspective; conceptual and analytical approaches ... context that there is con- siderable interest today in the process of shared decision- making (SDM) [2]. SDM is defined as a decision- making process jointly shared...
Ngày tải lên: 11/08/2014, 05:22
báo cáo khoa học: " Translating shared decision-making into health care clinical practices: Proof of concepts" pptx
... research initiative are many: International and interdisciplinary group of researchers dedicated to implementing SDM in clinical practice using a dyadic perspective; conceptual and analytical approaches ... analyze dyadic data and explore the impact of such analysis on the theoretical underpinnings guiding the implementation of SDM in clinical practice; and 3) to define a rese...
Ngày tải lên: 11/08/2014, 16:20
Báo cáo khoa học: The lactate dehydrogenases encoded by the ldh and ldhB genes in Lactococcus lactis exhibit distinct regulation and catalytic properties ) comparative modeling to probe the molecular basis pdf
... sufficient to sustain the lactate flux. Therefore, there must be an additional factor acting as an inhibitor of LDHB, and the best candidate is intracellular lactate. At an external pH of 5.5 (or lower), ... (Protein Data Bank code 1LDN) [38], containing NADH, oxamate and Fru(1,6)P 2 , solved at 2.5 A ˚ resolution, and of Lactobacillus pentosus (LDH- Lp) (Protein Data Bank code 1EZ4), c...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: A large complex mediated by Moc1, Moc2 and Cpc2 regulates sexual differentiation in fission yeast ppt
... GGGGATCCGTCGACCTGCAGCGTACGAAAGTACT GGTCGATTTAAGAC Moc3-Y GTTTAAACGAGCTCGAATTCATCGATGCTAGAC AAAATCACGC Moc3-Z GCCGTGGTCGGTTCCG Moc4 tagging primers Moc4-W CCTAAGCTGTGCGTTCAATC Moc4-X GGGGATCCGTCGACCTGCAGCGTACGAAGGAGA TTGCTTAATAGTTGCAC Moc4-Y ... GGGGATCCGTCGACCTGCAGCGTACGA CCACCA GGATTGAGCAC Moc2-Y GTTTAAACGAGCTCGAATTCATCGATGGGTTAC GTGCATCTGTG Moc2-Z CATGAGCTCAAAGCCTG Moc3 tagging primers Moc3...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: "Unsupervised Topic Identification by Integrating Linguistic and Visual Information Based on Hidden Markov Models" potx
... International Confer- ence on Multimedia(ACM-MM05), pages 6–11. Ryohei Sasano, Daisuke Kawahara, and Sadao Kuro- hashi. 2004. Automatic construction of nominal case frames and its application to indirect ... study considers a clause as an unit of analysis and the following eight topics as a set of states: prepara- tion, sauteing, frying, baking, simmering, boiling, dishing up, ste...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: "Pulmonary intravascular lymphoma diagnosed by 18fluorodeoxyglucose positron emission tomography-guided transbronchial lung biopsy in a man with long-term survival: a case report" pot
... Takimoto T, Nakata S, Shiga J, Nagate Y, Nakagawa T, Take H, Katagiri S: Intravascular large B-cell lymphoma presenting pulmonary arterial hypertension as an initial manifestation. Intern Med 2010, ... immunoperoxidase (B) stain of CD20. Black arrows show CD20 + lymphocytic infiltration inside the alveolar capillary, a characteristic finding of intravascular lymphoma. Niida et al. Journal o...
Ngày tải lên: 10/08/2014, 23:21
báo cáo khoa học: " Induction of stromule formation by extracellular sucrose and glucose in epidermal leaf tissue of Arabidopsis thaliana" pot
... 4:2. 7. Sattarzadeh A, Krahmer J, Germain AD, Hanson MR: A Myosin XI Tail Domain Homologous to the Yeast Myosin Vacuole-Binding Domain Interacts with Plastids and Stromules in Nicotiana benthamiana. ... manuscript; Naomi Marty and Michael Wozny for helping with English wording; Martin Paulmann, Max Paulmann and Armin Danziger for their kind support in marking plastids. This work...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice" pdf
... (5'-GGGGACAAGTTTGTACAAAAAAGCAG- GCTGTGATGGCGGCAGGAGAG-3') contained attB1 site (in bold) and WRKY12R (5'-GGGGACCACTTTGTACAA- GAAAGCTGGGTTGAACACGACGGCGCACTC-3') con- tained attB2 site (in bold), ... protein-DNA interaction analyses, and drafted the manuscript. JX generated the RNAi plants and per- formed cosegregating analysis, and protein-DNA interac- tion analy...
Ngày tải lên: 12/08/2014, 03:20
Tài liệu Báo cáo khoa học: Bioinformatics of the glycoside hydrolase family 57 and identification of catalytic residues in amylopullulanase from Thermococcus hydrothermalis doc
... (A) Q8TIT8_METAC AAM07401.1 378 MA4052 (a- amylase) ND Methanosarcina acetivorans C 2A (A) Q8TIT9_METAC AAM07400.1 396 MM0861 (a- amylase) ND Methanosarcina mazei Goe1 (A) Q8PYK0_METMA AAM30557.1 378 MM0862 ... Length ALR2450 ND Anabaena sp. PCC7120 (B) Q8YUA2_ANASP BAB74149.1 529 ALR1310 ND Anabaena sp. PCC7120 (B) Q8YXA5_ANASP BAB73267.1 744 ALR0627 ND Anabaena sp. PCC7120 (B) Q8YZ60_ANASP...
Ngày tải lên: 19/02/2014, 12:20