cáo khoa học: "To what extent do nurses use research in clinical practice? A systematic review" ppt

... CIHR Canada Research Chair in knowledge translation. Author details 1 Clinical Epidemiology Program, Ottawa Hospital Research Institute, Ottawa, Canada. 2 Faculty of Nursing, Deakin University, and ... their research training, research needs and of their use of research in clinical areas. Journal of Advanced Nursing 1999, 29(1):237-245. 79. Parahoo K: Research utilizatio...

Ngày tải lên: 10/08/2014, 10:23

... adults Hatzitaki et al [37] Pre-, post-testing in a moving obstacle avoidance task Lindemann et al [43] BF training was compared to home-based exercise Mudie et al [64] Training of sitting balance Santilli ... for training balance and mobility tasks in older populations: a systematic review Agnes Zijlstra 1* , Martina Mancini 2 , Lorenzo Chiari 2 , Wiebren Zijlstra 1 Abstract Contex...

Ngày tải lên: 19/06/2014, 08:20

... soft constraints on grammatical alternatives in one way or another. There are countless approaches to modelling these soft constraints, taking into account their interaction with various aspects ... Training linear SVMs in linear time. In Proceedings of the ACM Conference on Knowledge Discovery and Data Mining (KDD), pages 217–226. Nikiforos Karamanis, Massimo Poesioand Chris Mel- lish,...

Ngày tải lên: 31/03/2014, 21:20

... thrombin, the A- chain assumes an overall boomerang-like shape interacting with the B-chain sur- face opposite to the active site [17]. Stabilization within the A- chain and between the A- and B-chains ... experimentally. In analogy with the values calculated in enzymatic experiments, an increase of % 0.5 pK units of the His57 in DK9 mutant was also calculated analyzing the NAPAP dat...

Ngày tải lên: 07/03/2014, 12:20

... Tài liệu tham khảo [1] J. H. Argiris. Recent advances in matrix methods of structural analysis. Pergamon press. Oxford. 1964 (bản dịch tiếng Nga). [2] Hồ Anh Tuấn, Trần Bình. Phơng pháp ... đn hồi Winkler: MTCT c a dầm (xem [5]): A m B D m k C m k mD4AC m k B m k EJm B EJm C AmD4 EJm C EJm D m B A L 32 2 2 23 CT = áp dụng (4) ta rút ra dạng cuối cùng c a MTĐC c a phần...

Ngày tải lên: 06/08/2014, 05:21

... 245–254. 104 Bahr BA, Karanian DA, Makanji SS & Makriyannis A (2006) Targeting the endocannabinoid system in treating brain disorders. Expert Opin Investig Drugs 15, 351–365. 105 Franklin A, Parmentier-Batteur ... brain damage: the endocannabinoid system in the mechanisms of neuronal death Domenico E. Pellegrini-Giampietro 1 , Guido Mannaioni 1 and Giacinto Bagetta 2 1 Department o...

Ngày tải lên: 07/03/2014, 03:20

... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA A CCATGGAGAATCAAGAGAAGGCGAGTATCGCGG G-3¢ ... follow- ing the decrease in A 456 . Data analysis Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporat...

Ngày tải lên: 07/03/2014, 06:20

... for handling the gapping data, since the infelicity of gapping in non-parallel constructions hinged on there no longer being a propositional representation available as a source. 1 6In addition, ... to thank Stuart Shieber, Bar- bara Grosz, Fernando Pereira, Mary Dalrymple, Candy Sidner, Gregory Ward, Arild Hestvik, Shalom Lappin, Christine Nakatani, Stanley Chen, Karen Lochbaum,...

Ngày tải lên: 08/03/2014, 07:20

... molecular mass a- synuclein species that has an apparent mole- cular mass of 300 kDa is not accompanied by an increased Thioflavin T binding. Similarly, the PA700– a- synuclein complex that forms in ... NaCl; 1 mm EDTA, 5mm 2-mercaptoethanol) and increasing concentrations of PA700 as indicated. A total volume of 100 lL was aliquotted per well of a 96-well plate containing a Teflon sph...

Ngày tải lên: 16/03/2014, 22:20

... flavoproteins form a novel flavoprotein family in which all members contain an aromatic amino-acid residue (Phe, Trp) that interacts with the isoalloxazine ring of the flavin cofactor [31]. This conserved interaction ... L., Rovner, A. S. & Berger, C.L. (1998) Smooth muscle myosin mutants containing a single tryptophan reveal molecular interactions at the actin–binding interface. Proc...

Ngày tải lên: 23/03/2014, 15:21