cáo khoa học: " Strengthening evaluation and implementation by specifying components of behaviour change interventions: a study protocol" pdf
... (b) adequacy of information requ ired to undertake a replication, and (c) ease of identification of discrete BCTs. Acceptability will be evaluated as in phase 2b. Analysis Analyses of variance ... target audience with information about their behaviour) . The identification of behaviour change techniques (BCTs) is critical to understanding how organisational change and n...
Ngày tải lên: 10/08/2014, 10:23
... Localization of ADH1 and ADH4 in jejunum and ileum. ADH1 (A) and ADH4 (B) mRNA detection in jejunal mucosa. Immunodetection of ADH4 protein in ileal mucosa (C). Omission of anti-ADH4 IgG in an adjacent ... the rat, ADH1 has a low K m for ethanol and it is responsible for the hepatic ethanol metabolism [7]. ADH2 and ADH3 are not active at moderate concentrations of ethanol...
Ngày tải lên: 23/03/2014, 17:22
... this study were as follows: lac (26 bp), 5¢-ATTAATGTGAGTTAGCTCACTCATT A- 3¢ and 3¢-TAATTACACTCAATCGAGTGAGTAAT-5¢; gal (26 bp), 5¢-AAAAGTGTGACATGGAATAAATT AGT-3¢ and 3¢-TTTTCACACTGTACCTTATTTAATCA-5¢; ICAP ... 3¢-TTTTCACACTGTACCTTATTTAATCA-5¢; ICAP (28 bp), 5¢-AATTAATGTGACATATGTCACAT TAATT-3¢ and 3¢-TTAATTACACTGTATACAGTGTAAT TAA-5¢. The recognition half-sites are shown in bold. An equi...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: "Identifying Topic and Focus by an Automatic Procedure" pdf
... 1985] Eva Haji~Wi and Petr SgaU. Towards an automatic identification of topic and focus. Proceedings of the 2nd Conference of the European Chapter of the Association for Computational Linguistics, ... Directional(to) - Locative 2. An automatic identification of topic, focus and the degrees of communicative dynamism, discussed in a preliminary way by Haji6ova a...
Ngày tải lên: 18/03/2014, 02:20
báo cáo khoa học: "Rationale, design, and implementation protocol of an electronic health record integrated clinical prediction rule (iCPR) randomized trial in primary care" potx
... SD, Kaiser D, Dolan NC, Andrews B, Levi S, Khandekar J, Gavagan T, Thompson JA, Friesema EM, Baker DW: Changes in performance after implementation of a multifaceted electronic-health-record-based ... study implementation and trained providers. TPM conceived the study concept, protocol and design, supervised implementation and coordination, and help draft the manuscript....
Ngày tải lên: 10/08/2014, 11:20
báo cáo khoa học: "Social networks and implementation of evidencebased practices in public youth-serving systems: a mixed-methods study" potx
... of champions within peer networks that manage organizational agenda setting, change, and evaluation of change (e.g., data collection, eva- luation, and feedback). Studies and meta-analyses have also ... additional quantitative information on members of information and advice networks of study participants. A mixed-methods approach to data analysis was used to create...
Ngày tải lên: 10/08/2014, 11:20
Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx
... are collected for this work. The first type of data, called A- data, is a travel infor- mation data set harvested from the databases avail- able on the web, e.g., Wikipedia and Google Map. A- data ... DRs in a PST as a knowl- edge source for DA detection, we essentially need to model the relationship between the random DA and the random DR. Denote the random DA by X and the r...
Ngày tải lên: 20/02/2014, 05:20
Báo cáo khoa học: Adipocyte hyperplasia and RMI1 in the treatment of obesity doc
... Sakai T, Sakaue H, Nakamura T, Okada M, Matsuki Y, Watanabe E, Hiramatsu R, Nakayama K, Nakay- ama KI & Kasuga M (2007) Skp2 controls adipocyte proliferation during the development of obesity. ... the treatment of obesity Akira Suwa, Takeshi Kurama and Teruhiko Shimokawa Drug Discovery Research, Astellas Pharma Inc., Ibaraki, Japan Introduction Obesity is a complex disorder and...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... p Bottom O1 O2 O2 cl O3 O2 cro O1 O1 +–– –140 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA AGTAGGTTTTGTAAGCGGGAGGTGACAACATG TCATCCAAAACATTCGCCCTCCACTGTTGTAC ... DNA PCR11 GACTCAAGTACACGTATCGTGTATA GT...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... arabitolI, mannitolI, arabitolE, trehaloseE, oxalate and NADH (E, extracellular; I, intracellular) were skewed and therefore preprocessed by log-trans- formation. The rest of the variables [Aldolase ... tktA was sequenced by ligating the gene into pUC19 and using 33 P-labelled ddNTPs (Amersham-Pharmacia, Piscataway, NJ) by standard methods [35,36] covering all parts of the seq...
Ngày tải lên: 07/03/2014, 17:20