cáo khoa học: " Towards an organisation-wide process-oriented organisation of care: A literature review" pptx

... costs and organisation was not as dramatic as initially anticipated (initial targets were ambitious); The overall efficiency was not transformed (as assessed through a quantitative evaluation of its ... financial performance, operational effi- ciency, and patient satisfaction using hospital data and patient surveys [46]. Approaches used to move towards a process-oriented organisa...

Ngày tải lên: 10/08/2014, 10:23

... example, the word circular can be an adjective (marked as j, meaning 'circular'), a feminine noun (marked as nf, meaning 'note'), and a verb (marked as v, meaning 'move', ... Sopefia, C. Villar IBM Madrid Scientific Center Paseo de la Castellana, 4 28046 Madrid ABSTRACT Languages other than English have received little attention as far as the app...

Ngày tải lên: 24/03/2014, 05:21

... statistically analysed with SYSTAT. Cross-spe- cies means, standard deviations, minimum and maximum values for sapwood and heartwood concentrations were calculated separately for Gymnosperms and ... ratios of different elements were as - sessed by means of Spearman rank correlation coefficient. An allometric approach was applied to analyse correlation patterns be - tween heartwood and s...

Ngày tải lên: 08/08/2014, 14:21

... text semantic similarity. In Proceedings of AAAI-06. R. Mihalcea and P. Tarau. 2004. TextRank: Bringing order into texts. In Proceedings of EMNLP2004. R. Mihalcea and P.Tarau. 2005. A language ... recently, graph-based ranking methods, in- cluding TextRank ((Mihalcea and Tarau, 2004, 2005) and LexPageRank (ErKan and Radev, 2004) have been proposed for document summarization. Simila...

Ngày tải lên: 17/03/2014, 04:20

... set of output candidates is as follows: • You can buy a tent at Camping World. • You can purchase a tent at Camping World. • You can get a tent at Camping World. • You can acquire a tent at ... most natural-sounding candi- date (or at least one of the most natural-sounding candidates, if more than one candidate fits that cri- terion). There are a number of directions we...

Ngày tải lên: 17/03/2014, 06:20

... key- boards: Application to Catalan. Procesamiento del Lenguaje Natural, 27:65-70. Karin Harbusch, Saga Hasan, Hajo Hoffmann, Michael Kiihn, and Bernhard Schiller. 2003. Domain— specific disambiguation ... suggestions References John L. Arnott and Muhammad Y. Javed. 1992. Prob- abilistic character disambiguation for reduced key- boards using small text samples. AAC Augmentative and Alternat...

Ngày tải lên: 17/03/2014, 22:20

... (11) (a) John made a canoe out of a LOG. (b) John made a CANOE out of a log. (12) (a) John made a log into a CANOE. (b) It was a LOG John made into a canoe. Thus, in the (b) sentences a few ap- ... (TFA) is understood as one of the hierarchies of the level of meaning, whose other two hierarchies are that of dependency syn- tax (close to case grammar) and...

Ngày tải lên: 18/03/2014, 02:20

... Computer Research on the English Language Bowland College, University of Lancaster Bailrigg, Lancaster, England LA1 aYT. ABSTRACT Research has been under way at the Unit for Computer Research on ... ~hglish Language at the University of Lancaster, England, to develop a suite of computer programs which provide a detailed grammatical analysis of the LOB corpus, a collecti...

Ngày tải lên: 08/03/2014, 18:20

... R DORF3:3434 GCGTATTAAGAACTTACAAGG Within lgt1 R 2951:DORF 3A AACTCAACAAGATAGTCAAAC Within lgt2 2951 F 2951:UORF 3A ATGATAAAGTACTCAATGGTG Within lgt4 R Primers used to amplify and ⁄ or sequence ... TTTCTAGATTTATACCATGGTG Within lgt5 R DORF4:4132 AAAAGAAGACAAACAAGCAGC Within lgt5 R DORF4:5047 TTATCGGTACATATTGATTGG Downstream of lgt5 R Moraxella catarrhalis LOS biosynthesis I. R. Peak et al...

Ngày tải lên: 30/03/2014, 08:20

... h 2" alt =""

Ngày tải lên: 07/08/2014, 20:23