báo cáo khoa học: " A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision support" potx

... article as: Holroyd-Leduc et al.: A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision ... exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to ro...

Ngày tải lên: 10/08/2014, 10:23

... plans actions to satisfy an agent's goals, but allows some of the actions to consist of the utterance of sentences. This approach to language generation emphasizes the view of language ... only to observing the speaker's actions. The reader may wonder if an SI action can be regarded as a degenerate case of the NSI action. In the case of the...

Ngày tải lên: 21/02/2014, 20:20

... to a represen- tation of the predicate-argument part of the German IS grammar is more due to time constraints than to any far reaching claims about the mutual relationships between an IS and ... are taxonomic. These relate particular instances of what is to be expressed to the categories of semantic organisation that the grammar's seman- tics requires....

Ngày tải lên: 09/03/2014, 01:20

... mitochondria of A. franciscana and Ca 2+ uptake capacity are insensi- tive to BKA. Resistance to BKA may be a direct con- sequence of the unique sequence of the Artemia ANT. Results Effect of adenine ... differential affinity of ADP and ATP for Mg 2+ . The rate of ATP appearance in the medium fol- lowing addition of ADP to energized mitochondria was calculated fr...

Ngày tải lên: 29/03/2014, 00:20

...

Ngày tải lên: 07/08/2014, 18:21

... Initially, a synthetic DNA target was used to optimize the assay to assess the signal -to- noise ratios with a relatively large dynamic range and the highest signal obtainable. The standard lateral-flow ... (5’CGATCAGCAAC GCGGCGCCGCCGGCGTTGAGGTCGATC GCCCAC GTGACCTCGCCTCCATCGGCCAACGTCGTCACCG CCGCAATCA 3’). Lateral flow biosensor assay The assay was performed by mixing 1....

Ngày tải lên: 07/08/2014, 23:22

... with regard to the question that was asked, the evidence supporting use of clozapine was rather limited. The approach allows clinicians to use relatively weak evidence with other clinical skills. ... voices of her rapists saying derogatory comments to her. The patient's mirtazapine, chlorpromazine and olanzap- ine medication were stopped and she was started on hal...

Ngày tải lên: 08/08/2014, 21:20

... cells of Cajal [1]. They affect mostly males between the ages of 50 and 70, and are usually found inci- dentally at early stages [1-4]. Large or advanced lesions may present with a variety of clinical ... 4A an 4B. Pathologic examination corroborated the diagnosis of metastatic GIST with margins of resection free of tumor. The patient tolerated the procedure well and...

Ngày tải lên: 09/08/2014, 07:21

... our annotators to a particular set of emotions. This allows us to 1 Available for download at: http://research.microsoft.com/en-us/ downloads/ Questions about the data and the access process may ... Mechani- cal Turk 5 . It is a fast and relatively inexpensive way to get a large amount of data from many cul- tures all over the world. 3.1 MTurk and Data Quality Amazon Mec...

Ngày tải lên: 22/02/2014, 02:20

... Introduction Parameter estimation is fundamental to many sta- tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large ... investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model adaptation task. Then we apply the best of these estimators t...

Ngày tải lên: 08/03/2014, 02:21