báo cáo khoa học: " A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision support" potx
báo cáo khoa học: " A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision support" potx
... article as: Holroyd-Leduc et al.: A pragmatic study exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision ... exploring the prevention of delirium among hospitalized older hip fracture patients: Applying evidence to routine clinical practice using clinical decision supportJayna M Holroyd-Leduc1*, Greg A Abelseth1, ... throughout the study using an o perationsmanual. One of two t rained chart abstractors reviewed the hospital chart of each enrolled hip fracture patientadmitted during any one of 40 separate weekly assess-ment...
- 6
- 226
- 0
Tài liệu Báo cáo khoa học: "Some Pragmatic Issues in the Planning of Definite and Indefinite Noun Phrases" potx
... plans actions to satisfy an agent's goals, but allows some of the actions to consist of the utterance of sentences. This approach to language generation emphasizes the view of language ... only to observing the speaker's actions. The reader may wonder if an SI action can be regarded as a degenerate case of the NSI action. In the case of the NSI action, the speaker and hearer ... because there is no plan the hearer can formu- late to take advantage of the description. An example of such a nonuseful description would be if S and H are riding a bus, H asks at what stop...
- 6
- 658
- 0
Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf
... to a represen- tation of the predicate-argument part of the German IS grammar is more due to time constraints than to any far reaching claims about the mutual relationships between an IS and ... are taxonomic. These relate particular instances of what is to be expressed to the categories of semantic organisation that the grammar's seman- tics requires. These categories, and the ... projects. A partial implementation of the grammat- ical stratum of organisation found in Systemic Func- tional Grammar (SFG) provides the core of Penman's linguistic capabilities (Mann and Matthiessen,...
- 9
- 680
- 1
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... mitochondria of A. franciscana and Ca2+uptake capacity are insensi-tive to BKA. Resistance to BKA may be a direct con-sequence of the unique sequence of the Artemia ANT.ResultsEffect of adenine ... differential affinity of ADP and ATP forMg2+. The rate of ATP appearance in the medium fol-lowing addition of ADP to energized mitochondriawas calculated from the measured rate of change infree ... 829membrane potential (DWm) did not exceed the reversalpotential of ANT (see Fig. 3A) , the amount of ATPadded was assumed to be static, assisting the reliablecalculations of the total amount of...
- 15
- 505
- 0
Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx
... Initially, a synthetic DNA target was used to optimize the assay to assess the signal -to- noise ratios with a relatively large dynamic range and the highest signal obtainable. The standard lateral-flow ... (5’CGATCAGCAAC GCGGCGCCGCCGGCGTTGAGGTCGATCGCCCACGTGACCTCGCCTCCATCGGCCAACGTCGTCACCGCCGCAATCA 3’).Lateral flow biosensor assay The assay was performed by mixing 1.5 μl (1.5 μg) of the target ... liposomes. Annealing at 60oC was done to prevent the re-association of thermally-denatured double-stranded DNA strands. Lateral-flow biosensor assay with the RT-PCR product of the RNA extracted...
- 8
- 385
- 0
Báo cáo y học: "A case study evaluating the use of clozapine in depression with psychotic feature" docx
... with regard to the question that wasasked, the evidence supporting use of clozapine was ratherlimited. The approach allows clinicians to use relativelyweak evidence with other clinical skills. ... voices of her rapists sayingderogatory comments to her. The patient's mirtazapine, chlorpromazine and olanzap-ine medication were stopped and she was started onhaloperidol and amitriptyline. ... morning and 300mg at night. She was subsequently reviewed in the outpa-tient clinic regularly and has remained well.Another literature search (of the same original databases)yielded no further evidence...
- 6
- 495
- 0
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx
... cells of Cajal [1]. They affect mostly malesbetween the ages of 50 and 70, and are usually found inci-dentally at early stages [1-4]. Large or advanced lesionsmay present with a variety of clinical ... 4A an4B. Pathologic examination corroborated the diagnosis of metastatic GIST with margins of resection free of tumor. The patient tolerated the procedure well and was senthome after a 14-day ... hospitalization. The postoperativecourse was complicated by the formation of a subhepaticabscess that was successfully treated with drainage cathe-ters and systemic antibiotics. Imatinib was...
- 4
- 454
- 0
Tài liệu Báo cáo khoa học: "A Lexicon for Exploring Color, Concept and Emotion Associations in Language" doc
... our annotators to a particular set of emotions. This allows us to 1Available for download at:http://research.microsoft.com/en-us/downloads/Questions about the data and the access process may ... Mechani-cal Turk5. It is a fast and relatively inexpensiveway to get a large amount of data from many cul-tures all over the world.3.1 MTurk and Data QualityAmazon Mechanical Turk is a crowdsourcingplatform ... quality of expert annotations on a variety of natural language tasks, but the cost of the annota-tion is much lower.There are various quality control strategies thatcan be used to ensure annotation...
- 9
- 527
- 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... Introduction Parameter estimation is fundamental to many sta-tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large ... investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model adaptation task. Then we apply the best of these estimators to two additional tasks involving ... tasks). We assume we are given fixed feature templates from which a large number of features are generated. The task of the estimator is to use the training samples to choose a parameter vector ,...
- 8
- 504
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP