báo cáo khoa học: " Employing external facilitation to implement cognitive behavioral therapy in VA clinics: a pilot study" pdf
báo cáo khoa học: " Employing external facilitation to implement cognitive behavioral therapy in VA clinics: a pilot study" pdf
... 5:75 http://www.implementationscience.com/content/5/1/75 Page 9 of 11 RESEARC H ARTIC LE Open Access Employing external facilitation to implement cognitive behavioral therapy in VA clinics: a pilot study Michael ... Rycroft-Malone J, Bowman C, Curran G, Guihan M, Hagedorn H, Pineros S, Wallace C: Role of external facilitation in implementation of research finding...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: " Barriers and facilitators to implementing shared decision-making in clinical practice: a systematic review of health professionals'''' perceptions" ppt
... Université Laval, Québec, Canada and 3 Faculty of Health Sciences, University of Ottawa, Ottawa, Canada Email: Karine Gravel - karine.gravel@crsfa.ulaval.ca; France Légaré* - france.legare@mfa.ulaval.ca; ... Edwards A, Elwyn G: Involving patients in decision making and communicating risk: a longitudinal evaluation of doctors' attitudes and confidence during a randomized trial. J...
Ngày tải lên: 11/08/2014, 05:22
báo cáo khoa học:" Does laparoscopic management of deep infiltrating endometriosis improve quality of life? A prospective study" pdf
... endometriosis and the scoring of pelvic pain symptoms using a 10-point visual analogue scale (VAS). All women underwent gynaecological examination, pelvic trans-vaginal and abdominal ultra-sonography in order ... Liaras E, Fauconnier : A Laparoscopically assisted vaginal management of deep endometriosis infiltrating the rectovaginal septum. Acta Obstet Gynecol Scand 2001, 80:349-354. 15...
Ngày tải lên: 12/08/2014, 00:20
Tài liệu Báo cáo khoa học: Exposure of IgG to an acidic environment results in molecular modifications and in enhanced protective activity in sepsis doc
... two commercially available IVIg preparations [Endobulin (solid line); Octagam (dashed line)] to human factor H. Data represent mean absorbance values ± standard deviation of quadruplicate wells in one ... monoclonal Z2 antibody in the presence of increasing concentrations of potassium thiocyanate (ranging from 0 to 2.0 m). After incubation and washing, the antibody binding was mea- su...
Ngày tải lên: 16/02/2014, 15:20
Báo cáo khoa học: Binding of cGMP to the transducin-activated cGMP phosphodiesterase, PDE6, initiates a large conformational change involved in its deactivation ppt
... 34284– 34292. 35 Yamazaki A, Yu H, Yamazaki M, Honkawa H, Matsu- ura I, Usukura J & Yamazaki RK (2003) A critical role for ATP in the stimulation of retinal guanylyl cyclase by guanylyl cyclase-activating ... of cGMP binding during activation of Pabcc Two possible stages for cGMP binding to Pabc are expected in PDE regulation: during Pabcc activation to Pabc and during Pabc dea...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: "Using Deep Morphology to Improve Automatic Error Detection in Arabic Handwriting Recognition" pot
... they use are shallow and restricted to breaking up a word into prefix+stem+suffix; whereas we ana- lyze words into their lemmas, abstracting away over a large number of variations. We also made use ... Lin- guistics. Shirin Saleem, Huaigu Cao, Krishna Subramanian, Marin Kamali, Rohit Prasad, and Prem Natarajan. 2009. Improvements in BBN’s HMM-based Offline Hand- writing Recognition Syste...
Ngày tải lên: 17/03/2014, 00:20
Báo cáo khoa học: "Effects of exposure to air on planting stress in red oak seedlings" ppsx
... delayed planting, and to relate these variables to mortality and new root and shoot growth after planting. MATERIALS AND METHODS Plant material and experimental set-up One ... growth after plant- ing. The effects of exposure appeared to be related to the desiccation of the different plant components rather than to decreased carbon availability...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo khoa hoc:" Role of HOXA7 to HOXA13 and PBX1 genes in various forms of MRKH syndrome (congenital absence of uterus and vagina)" ppt
... TTGGTGTAAATCTGGGGGTG TTAAAACCAGAAAGGCTGCG 637 HOXA 7-2-F HOXA 7-2-R HOXA-7 exon 2 GACTAGGCCAGGAGGAAGGT GGGAGCTGGAGTAGGTGATG 697 HOXA 9- 1a- F HOXA 9- 1a- R HOXA-9 exon 1 (first half) TGCCACCAAGTTGTTACATGA CAGCGGTTCAGGTTTAATGC 492 HOXA ... overall data led us to investigate HOXA7, -A9 , -A1 0, -A1 1 and -A1 3 genes, as well as PBX1, in several MRKH patients showing a wide range of malfo...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx
... III and Daniel Marcu. 2006. Domain adap- tation for statistical classifiers. In Journal of Artifi- cial Intelligence Research. Hal Daum ´ e III. 2007. Frustratingly easy domain adap- tation. In ... and Representation: Bootstrapping Annotated Language Data. David Chiang. 2007. Hierarchical phrase-based trans- lation. Computational Linguistics, pages 201–228. Michael Collins and Brian Roark....
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: Enzymatic control of anhydrobiosis-related accumulation of trehalose in the sleeping chironomid, Polypedilum vanderplanki pdf
... 45. 54 Watanabe M, Nakahara Y, Sakashita T, Kikawada T, Fujita A, Hamada N, Horikawa DD, Wada S, Kobayashi Y & Okuda T (2007) Physiological changes leading to anhydrobiosis improve radiation tolerance ... Saito A, Kanamori Y, Nakahara Y, Iwata K-I, Tanaka D, Watanabe M & Okuda T (2007) Treha- lose transporter 1, a facilitated and high-capacity treha- lose transporter, allows exo...
Ngày tải lên: 29/03/2014, 21:20