báo cáo khoa học: " The IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness program in fire departments" ppsx
... IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness program in fire departments. Implementation ... 5:73 http://www.implementationscience.com/content/5/1/73 Page 6 of 8 STUD Y PROT O C O L Open Access The IGNITE (investigation to guide...
Ngày tải lên: 10/08/2014, 10:23
... large stomatal opening that induces transpiration is a necessary conse- quence of the plant’s need to maintain gas exchange in leaves for photosynthesis. To maintain a favourable wa- ter balance, ... was measured when flow became in a steady state and K branch was calculated as the ratio between F and P: K = F / P. The LSC of the branch was calculated as the rati...
Ngày tải lên: 08/08/2014, 14:20
... DeBenedetti, A. & Graff, J.R. (2000) Translational control of malignancy: the mRNA cap-binding protein, eIF-4E, as a central regulator of tumor formation, growth, invasion and metastasis. Anticancer ... HIFa protein synthesis in the cell and results in increased HIFa protein and transcriptional activity. MAPK also activates HIFa protein synthesis and addi- tionally may pot...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt
... [2,3]. The autophagic pathway is crucial for maintaining cell homeostasis and disruption to the pathway can be a contributing factor to many diseases. Decreased autophagy may promote the development of ... overexpressing Beclin 1DBcl2BD, it is possible to reinterpret the observation of increased numbers of autophagosomes as an indication of impaired autophago- lyso...
Ngày tải lên: 07/03/2014, 09:20
báo cáo khoa học: "Intracranial hypotension secondary to spinal arachnoid cyst rupture presenting with acute severe headache: a case report" ppsx
... the clinical care of the patient and all have reviewed and approved the final manuscript. PD will act as guarantor for the manuscript and is the corresponding author. Competing interests The authors ... subarachnoid haemorrage. Investigations including a computed tomography brain scan, cerebrospinal fluid examination and a magnetic resonance angiogram were normal. The he...
Ngày tải lên: 11/08/2014, 02:22
Báo cáo khoa học: Cadmium – glutathione solution structures provide new insights into heavy metal detoxification potx
... Molecular mechanisms of proline-mediated toler- ance to toxic heavy metals in transgenic microalgae. Plant Cell 14, 2837–2847. Supporting information The following supplementary material is available: Fig. ... new insights into heavy metal detoxification Olivier Delalande 1, *, Herve ´ Desvaux 2 , Emmanuel Godat 1,3 , Alain Valleix 4 , Christophe Junot 3 , Jean Labarre 1 and Yves B...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: "Gemcitabine/cisplatin versus 5-fluorouracil/ mitomycin C chemoradiotherapy in locally advanced pancreatic cancer: a retrospective analysis of 93 patients" pptx
... Heinemann V, Labianca R, Hinke A, Louvet C: Increased survival using platinum analog combined with gemcitabine as compared to single- agent gemcitabine in advanced pancreatic cancer: pooled analysis ... Heinemann V, Boeck S, Hinke A, Labianca R, Louvet C: Meta-analysis of randomized trials: evaluation of benefit from gemcitabine-based combination chemotherapy applied in advanced p...
Ngày tải lên: 09/08/2014, 09:20
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 min when assayed at 35 °C (Fig. 3A, B). The presence of Ca 2+ increased the thermal stability of PhyH and ... phosphate over adjacent ones, and degrades InsP 6 gradually into InsP 5 , InsP 4 , and the final product – Ins(2,4,6)P 3 and Ins(1,3,5)P 3 – via two alternative pathways [14]. Bac...
Ngày tải lên: 14/02/2014, 15:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... be simultaneously engaged in mRNA decay in an ARE- mediated manner [45], suggesting that the pathway of mammalian ARE-mediated mRNA decay can be flexible. Recently,...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc
... M RNaseA WB anti-flag WB anti-HA HA TIAR Merged DAPI TIAR-flag BOIP-flag HA-DDX21 RNaseA WB anti-flag WB anti-HA B HA-ASF/SF2 HA-p68 HA-hnRNP M HA-DDX21 Fig. 2. (A) Analysis of the identified interac- tions ... regulate the translation of various mRNAs bearing AREs in their 3¢ UTR. For example, mRNAs encoding human matrix metallinoproteinase- 13 and b 2 -adrenergic receptor are tra...
Ngày tải lên: 16/02/2014, 15:20