báo cáo khoa học: " The IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness program in fire departments" ppsx

... IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness program in fire departments.Implementation ... 5:73http://www.implementationscience.com/content/5/1/73Page 6 of 8STUD Y PROT O C O L Open Access The IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness ... adoption and effective use of worksite well-ness programs; and the translational model can bevalidated and manipulated in this and other settings to better understand and make translation more...

Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx

... large stomatalopening that induces transpiration is a necessary conse-quence of the plant’s need to maintain gas exchange in leaves for photosynthesis. To maintain a favourable wa-ter balance, ... wasmeasured when flow became in a steady state and Kbranchwas calculated as the ratio between F and P:K = F / P. The LSC of the branch was calculated as the ratio be-tween Kbranchand the leaf ... transpiration.Therefore, sun-exposed branches are able to sustain a high climatic water demand andare able toresist to waterdeficit by maintaining xylem integrity with a low vulner-ability and an...

Tài liệu Báo cáo khoa học: The subtle side to hypoxia inducible factor (HIFa) regulation pdf

... DeBenedetti, A. & Graﬀ, J.R. (2000) Translational control of malignancy: the mRNA cap-binding protein, eIF-4E, as a central regulator of tumor formation, growth, invasion andmetastasis. Anticancer ... HIFa protein synthesis in the cell and results in increased HIFa protein and transcriptional activity.MAPK also activates HIFa protein synthesis and addi-tionally may potentiate HIF 1a transcriptional ... levels are limiting [17,48].Increased translation of HIFa mRNA ultimately leads to an increase in the HIFa protein pool, thus explaining initialreports that observed increased HIFa protein in response...

Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt

... [2,3]. The autophagic pathway is crucial for maintainingcell homeostasis and disruption to the pathway can be a contributing factor to many diseases. Decreasedautophagy may promote the development of ... overexpressing Beclin 1DBcl2BD, it is possible to reinterpret the observation of increased numbers of autophagosomes as an indication of impaired autophago-lysosomal clearance rather than increased autophagy.Although ... between the autophagic and apoptotic pathways. Recently, a BH3 domain in the Bcl-2-binding domain of Beclin 1was shown to bind to Bcl-XL[13]. Anti-apoptotic Bcl-2and Bcl-XLhave been shown to activate...

báo cáo khoa học: "Intracranial hypotension secondary to spinal arachnoid cyst rupture presenting with acute severe headache: a case report" ppsx

... the clinical care of the patient and all have reviewed and approved the finalmanuscript. PD will act as guarantor for the manuscript and is the corresponding author.Competing interests The authors ... subarachnoidhaemorrage. Investigations including a computed tomography brain scan, cerebrospinal fluid examination and a magnetic resonance angiogram were normal. The headache persisted and magnetic ... complaint and has a wide differential diagnosis. Clinicians need to be alert to clues that may suggest an underlying secondary aetiology. We describe a novel case of headachesecondary to intracranial...

Báo cáo khoa học: Cadmium – glutathione solution structures provide new insights into heavy metal detoxiﬁcation potx

... Molecular mechanisms of proline-mediated toler-ance to toxic heavy metals in transgenic microalgae.Plant Cell 14, 2837–2847.Supporting information The following supplementary material is available:Fig. ... new insights into heavy metal detoxiﬁcationOlivier Delalande1,*, Herve´Desvaux2, Emmanuel Godat1,3, Alain Valleix4, Christophe Junot3, JeanLabarre1and Yves Boulard11 Laboratoire ... Nevertheless, the nature of the metal binding in the case of GSH remains subject to debate, as cadmium has been proposed to link to amide [15], carboxylates of both glycine [13,14] andglutamate...

Báo cáo khoa học: "Gemcitabine/cisplatin versus 5-fluorouracil/ mitomycin C chemoradiotherapy in locally advanced pancreatic cancer: a retrospective analysis of 93 patients" pptx

... Heinemann V, Labianca R, Hinke A, Louvet C: Increased survival usingplatinum analog combined with gemcitabine as compared to single-agent gemcitabine in advanced pancreatic cancer: pooled analysis ... Heinemann V, Boeck S, Hinke A, Labianca R, Louvet C: Meta-analysis of randomized trials: evaluation of benefit from gemcitabine-basedcombination chemotherapy applied in advanced pancreatic cancer. ... Toxicity and efficacy of concurrent gemcitabineand radiotherapy for locally advanced pancreatic cancer. IntJPancreatol2001, 29(1):9-18.21. Eppinga W, Lagerwaard F, Verbakel W, Slotman B, Senan S:...

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efﬁciency doc

... was basically stable at 35 °C, and retained60% of the initial activity at 45 °C for 90 min whenassayed at 35 °C (Fig. 3A, B). The presence of Ca2+increased the thermal stability of PhyH and ... phosphate over adjacentones, and degrades InsP6gradually into InsP5, InsP4,and the ﬁnal product – Ins(2,4,6)P3and Ins(1,3,5)P3–via two alternative pathways [14].Bacterial BPPs containing ... greater than the activity sum of PhyH-DI andPhyH-DII and two times greater than that of PhyH-DII. This large variance cannot be ascribed to the function of PhyH-DI alone. The dual-domain phytasewas...

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2)SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)SJS262 AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... besimultaneously engaged in mRNA decay in an ARE-mediated manner [45], suggesting that the pathway of mammalian ARE-mediated mRNA decay can beﬂexible. Recently, an excellent database compiling AREcontaining ... domain either 5¢ or 3¢ to the core domain resulted in a similar deadenylation and overall mRNA decayrate [33]. The PAI-2 ARE is unusual in that in addition to an auxiliary domain (Fig. 7, the atypicalAU-rich...

Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

... MRNaseAWB anti-flagWB anti-HAHA TIAR Merged DAPITIAR-flagBOIP-flagHA-DDX21RNaseAWB anti-flagWB anti-HABHA-ASF/SF2HA-p68HA-hnRNP MHA-DDX21Fig. 2. (A) Analysis of the identiﬁed interac-tions ... regulate the translation of variousmRNAs bearing AREs in their 3¢ UTR. For example,mRNAs encoding human matrix metallinoproteinase-13 and b2-adrenergic receptor are translationalyrepressed ... western blotanalysis with anti-Flag and anti-HA sera. The speciﬁc-ity of the interactions was evaluated by IP of the unre-lated BOIP-Flag protein [20]. As shown in Fig. 2A, all the candidates identiﬁed...

Xem thêm