báo cáo khoa học: " Process evaluation of a participatory ergonomics programme to prevent low back pain and neck pain among workers" pdf

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... fromGiardia lamblia, which contains a Trp residue at the structurally equiva-lent position, establishes the need for complementary mutations and maintenance of weak interactions in order to accommodate...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... proteins contained in aggregates within theotolith matrix and identiﬁed a protein contained in the HMW protein glycosaminoglycan aggregate thatalso contains the otolith structural protein otolin-1.This ... digestion of genomic DNA con-tamination in the total RNA was conﬁrmed by lack of ampliﬁcation of a b-actin mRNA fragment by PCR using a pair of primers (5Â -ATCACCATCGGCAACGAGAG-3Âand 5Â-TGGAGTTGTAGGTGGTCTCGTG-3Â) ... macromolecule-64(OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of this protein, we revealed that the aggregate also contains theinner ear-speciﬁc collagen otolin-1 [9].ResultsCloning...

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... nm, and at the same time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. ... vanishedafter 30 min, and instead, an absorption peakappeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu-ally and was replaced by a new broad band ... Fig. 5A, addition of ascorbate to the solution of heme GmHO-1 initiates the reaction, as revealed by gradual diminution of the Soret band. After several minutes, a broad bandappears at around...

Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of speciﬁcity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

... Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of speciﬁcity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates Ramasubramanian ... suite: programs for protein crystallo-graphy.Acta Crystallogr D Biol Crystallogr 50, 760–763.28 Navaza J (1994) Amore – an automated package formolecular replacement. Acta Crystallogr A 50, 157–163.29 ... parameters (B-factors) and, whereappropriate, the ligand occupancies.Superposition of subunit A on B and C (468 Caatoms) in complex II and III of LlPDH gives an rmsd of 1.6 A ˚in each case,...

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... abzymes; nitrosoalcanes;microperoxidase 8; S-oxidation. Catalytic antibodies with a metalloporphyrin cofactor, orÔhemoabzymesÕ, are not as efﬁcient a category of catalysts astheir natural hemoprotein ... set of six monoclonalantibodies was thus obtained: the best peroxidase activity –that found with the complex of MP8 and one of thoseantibodies, 3A3 – was characterized by a kcat/Kmvalue of 2 ... counterparts. The hemoabzymes,which display a peroxidase activity, are characterized bykcat/Kmvalues that are three to four orders of magnitudelower than those for natural peroxidases [1]....

Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

... The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase 1What is the role of quinonoid intermediates?Nicolai G. Faleev1, Tatyana V. Demidkina2, Marina ... sidechain of any bound amino ac id. The lability of the a-proton observed for a large number of amino acids [5] under the action of TPL gives evidence for the orthogonal orientation of the a-proton ... group of the s ubstrate, when the external aldimine is formed. The anchoring of a-carboxylateand a -amino group in the external aldimine deﬁnesautomatically the positions of the a-proton and the...

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... alkyla-tion leading to a depletion of mtDNA in intact cells(Fig. 1). Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... should also alkylate mtDNA within mitochondria and cells.MitoDC-81 does not alkylate mtDNA in isolated mitochondria Having ascertained that mitoDC-81 was sequestered byisolated mitochondria and ... plasma membrane potential and thenbe further accumulated within the mitochondria due to themitochondrial membrane potential [11]. From the knownplasma and mitochondrial membrane potentials and...

Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

... Computational LinguisticsHuman Evaluation of a German Surface Realisation RankerAoife CahillInstitut făur Maschinelle Sprachverarbeitung (IMS)University of Stuttgart70174 Stuttgart, Germanyaoife.cahill@ims.uni-stuttgart.deMartin ... evaluation metrics cannotbe avoided, but ideally, a metric for the evaluation of realisation rankers would rank alternative real-isations in the same way as native speakers of thelanguage for ... Germanyaoife.cahill@ims.uni-stuttgart.deMartin ForstPalo Alto Research Center3333 Coyote Hill RoadPalo Alto, CA 94304, USAmforst@parc.comAbstractIn this paper we present a human-based evaluation of...

Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate speciﬁcity doc

... Sequence alignment of the catalytic domain of 14 histone acetyltransferase sequences.Fig. S2. Relative solvent accessibility of amino acidresidues of the catalytic domain of P ⁄ CAF.Fig. S3. Example ... domain of the human HAT P ⁄ CAF, with-out affecting its catalytic activity or substrate speciﬁc-ity. P ⁄ CAF, p300 ⁄ CBP-associating factor, is a transcriptional coactivator with a variable ... Crystal structure of the his-tone acetyltransferase domain of the human PCAFtranscriptional regulator bound to coenzyme A. EMBOJ 18, 352 1–3 532.35 Ahmad S, Gromiha MM, Fawareh H & Sarai A...

Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

... Growth and flowering in roses. Acta Hor-tic 218, 121-130 Original articleAn evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different ... control (Barnola et al, 1986;Alatou et al, 1989; Barnola et al, 1990; Par-mentier et al, 1991; Barnola et al, 1993). As the formation of lateral branchesappears to differ ... inves-tigated the relationship between genotype, branching and temperature, were made inorder to evaluate the use of decapitation as a method for selecting clonal oak with different...

Báo cáo khoa học: "Dramatic response of a gastrointestinal stromal tumor to neadjuvant imatinib therapy" pptx

... G,Rahman A, Chen G, Staten A, Griebel D, Pazdur R: Approval Sum-mary: Imatinib mesylate in the treatment of metastatic and/or unresectable malignant gastrointestinal stromal tumors.Clin Cancer ... CentralPage 1 of 3(page number not for citation purposes)World Journal of Surgical OncologyOpen AccessCase reportDramatic response of a gastrointestinal stromal tumor to neadjuvant imatinib ... themetastatic and adjuvant settings. We report the case of a 61-year old man who was treated withneoadjuvant imatinib for a massive gastric GIST with the hope of avoiding a potential multi-visceralresection.Case...

báo cáo khoa học: " Process evaluation of a participatory ergonomics programme to prevent low back pain and neck pain among workers" pdf

... 5:65http://www.implementationscience.com/content/5/1/65Page 9 of 11 RESEARC H ARTIC LE Open Access Process evaluation of a participatory ergonomics programme to prevent low back pain and neck pain among workersMaurice T Driessen1,2, Karin I Proper1,2, ... Proper1,2, Johannes R Anema1,2*, Paulien M Bongers1,2,3, Allard J van der Beek1,2AbstractBackground: Both low back pain (LBP) and neck pain (NP) are major occupational health problems. ... were a solid representation of the largest and most important task groups at the department. Ifavailable, an occupational health and safety coordinatorwas incorporated in the working group as...

báo cáo khoa học: "Process evaluation of appreciative inquiry to translate pain management evidence into pediatric nursing practice" ppt

... al.: Process evaluation of appreciative inquiry to translate pain management evidence into pediatric nursing practice. Implementation Science 2010 5:90.Submit your next manuscript to BioMed Centraland ... 5:90http://www.implementationscience.com/content/5/1/90Page 13 of 13 RESEARC H ARTIC LE Open AccessProcess evaluation of appreciative inquiry to translate pain management evidence into pediatric nursing practiceTricia Kavanagh1,2*, ... using pain management evidence inpracticeActivities Introduction to the AI process;explanation of ‘high’ evidence applied to pediatric pain management; reframing evidence- based pain management...

báo cáo khoa học: " Usability evaluation of a clinical decision support tool for osteoporosis disease management" pps

... RESEARC H ARTIC LE Open Access Usability evaluation of a clinical decision support tool for osteoporosis disease managementMonika Kastner1*†, Danielle Lottridge2†, Christine Marquez3†, David ... in April, 2010.14. Cranney A, Papaioannou A, Zytaruk N, Hanley D, Adachi J, for the Clinical Guidelines Committee of Osteoporosis Canada, et al: Parathyroid hormone for the treatment of osteoporosis: ... physician. The moderator also askedparticipants to rate the rea dability, understandability,and format of the COPE sheet using a verbal five-pointLikert scale.Data collection and analysisAll usability...

báo cáo khoa học:" Psychometric evaluation of a radio electric auricular treatment for stress related disorders: a double-blinded, placebo-controlled controlled pilot study" pps

... evaluation of a radio electric auricular treatment for stress related disorders: a double-blinded, placebo -controlled controlled pilot studySalvatore Rinaldi1,2*†, Vania Fontani2†, Lucia Aravagli2†, ... this article as: Rinaldi et al.: Psychometric evaluation of a radio electric auricular treatment for stress related disorders: a double-blinded, placebo -controlled controlled pilot study. Health ... Protective and damaging effects of mediators of stress. Elaborating and testing the concepts of allostasis and allostaticload. Ann N Y Acad Sci 1999, 896:30-47.18. Stewart JA: The detrimental effects...

Xem thêm