... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F...
Ngày tải lên: 18/02/2014, 11:20
... proteins contained in aggregates within the otolith matrix and identified a protein contained in the HMW protein glycosaminoglycan aggregate that also contains the otolith structural protein otolin-1. This ... digestion of genomic DNA con- tamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... nm, and at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. ... vanished after 30 min, and instead, an absorption peak appeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu- ally and was repl...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
... Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates Ramasubramanian ... suite: programs for protein crystallo- graphy. Acta Crystallogr D Biol Crystallogr 50, 760–763. 28 Navaza J (1994) Amore – an automated package for mo...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
... abzymes; nitrosoalcanes; microperoxidase 8; S-oxidation. Catalytic antibodies with a metalloporphyrin cofactor, or ÔhemoabzymesÕ, are not as efficient a category of catalysts as their natural hemoprotein ... set of six monoclonal antibodies was thus obtained: the best peroxidase activity – that found with the complex of MP8 and one of those antibodies, 3A3 – was character...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc
... The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase 1 What is the role of quinonoid intermediates? Nicolai G. Faleev 1 , Tatyana V. Demidkina 2 , Marina ... side chain of any bound amino ac id. The lability of the a-proton observed for a large number of amino acids [5] under the action of TPL gives ev...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... alkyla- tion leading to a depletion of mtDNA in intact cells (Fig. 1). Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... should also alkylate mtDNA within mitochondria and cells. MitoDC-81 does not alkylate mtDNA in isolated mitochondria Having ascertained that mitoDC-81 was sequeste...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
... Computational Linguistics Human Evaluation of a German Surface Realisation Ranker Aoife Cahill Institut făur Maschinelle Sprachverarbeitung (IMS) University of Stuttgart 70174 Stuttgart, Germany aoife.cahill@ims.uni-stuttgart.de Martin ... evaluation metrics cannot be avoided, but ideally, a metric for the evaluation of realisation rankers would rank alternative real-...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc
... Sequence alignment of the catalytic domain of 14 histone acetyltransferase sequences. Fig. S2. Relative solvent accessibility of amino acid residues of the catalytic domain of P ⁄ CAF. Fig. S3. Example ... domain of the human HAT P ⁄ CAF, with- out affecting its catalytic activity or substrate specific- ity. P ⁄ CAF, p300 ⁄ CBP-associating factor, is a trans criptio...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt
... Growth and flowering in roses. Acta Hor- tic 218, 121-130 Original article An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different ... control (Barnola et al, 1986; Alatou et al, 1989; Barnola et al, 1990; Par- mentier et al, 1991; Barnola et al, 1993). As the formation of latera...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa học: "Dramatic response of a gastrointestinal stromal tumor to neadjuvant imatinib therapy" pptx
... G, Rahman A, Chen G, Staten A, Griebel D, Pazdur R: Approval Sum- mary: Imatinib mesylate in the treatment of metastatic and/ or unresectable malignant gastrointestinal stromal tumors. Clin Cancer ... Central Page 1 of 3 (page number not for citation purposes) World Journal of Surgical Oncology Open Access Case report Dramatic response of a gastrointestinal stromal tu...
Ngày tải lên: 09/08/2014, 04:21
báo cáo khoa học: " Process evaluation of a participatory ergonomics programme to prevent low back pain and neck pain among workers" pdf
... 5:65 http://www.implementationscience.com/content/5/1/65 Page 9 of 11 RESEARC H ARTIC LE Open Access Process evaluation of a participatory ergonomics programme to prevent low back pain and neck pain among workers Maurice T Driessen 1,2 , Karin I Proper 1,2 , ... Proper 1,2 , Johannes R Anema 1,2* , Paulien M Bongers 1,2,3 , Allard J van der Beek 1,2 Abstract...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: "Process evaluation of appreciative inquiry to translate pain management evidence into pediatric nursing practice" ppt
... al.: Process evaluation of appreciative inquiry to translate pain management evidence into pediatric nursing practice. Implementation Science 2010 5:90. Submit your next manuscript to BioMed Central and ... 5:90 http://www.implementationscience.com/content/5/1/90 Page 13 of 13 RESEARC H ARTIC LE Open Access Process evaluation of appreciative inquiry to...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: " Usability evaluation of a clinical decision support tool for osteoporosis disease management" pps
... RESEARC H ARTIC LE Open Access Usability evaluation of a clinical decision support tool for osteoporosis disease management Monika Kastner 1*† , Danielle Lottridge 2† , Christine Marquez 3† , David ... in April, 2010. 14. Cranney A, Papaioannou A, Zytaruk N, Hanley D, Adachi J, for the Clinical Guidelines Committee of Osteoporosis Canada, et al: Parathyroid hor...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học:" Psychometric evaluation of a radio electric auricular treatment for stress related disorders: a double-blinded, placebo-controlled controlled pilot study" pps
... evaluation of a radio electric auricular treatment for stress related disorders: a double-blinded, placebo -controlled controlled pilot study Salvatore Rinaldi 1,2*† , Vania Fontani 2† , Lucia Aravagli 2† , ... this article as: Rinaldi et al.: Psychometric evaluation of a radio electric auricular treatment for stress related disorders:...
Ngày tải lên: 12/08/2014, 01:21