báo cáo khoa học: " What are possible barriers and facilitators to implementation of a Participatory Ergonomics programme?" docx

... determining errors, we are Commentary What do we know about medication errors made via a CPOE system versus those made via handwritten orders? Ross Koppel Center for Clinical Epidemiology and Biostatistics, ... what we understand by medication errors , what we mean by ‘computerized physician order entry (CPOE) systems’, how we measure errors, and w...

Ngày tải lên: 25/10/2012, 10:39

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specifici...

Ngày tải lên: 14/02/2014, 14:20

... for actin- cytoskeleton polarization: a novel C-terminal actin- binding submod- ule (CABS) that contains a novel G -actin- binding domain, which we call a verprolin homology 2 C-terminal (VH2-C) domain; and a second ... polarization of the yeast actin cytoskele- ton. The presence of the novel actin- binding VH2-C domain in C-Vrp1p 364)817 may explain...

Ngày tải lên: 18/02/2014, 16:20

... 2004 FEBS Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) Emmanuelle Cotto 1,2 , Miche ` le Andre ´ 1 , ... mammalian origin by the fish intestine. Comparison of zebrafish prp1, prp2, and prp3 developmental expression patterns The developmental expression patt...

Ngày tải lên: 19/02/2014, 16:20

... containing a complete x-5 gliadin gene, oligonucleo- tides, 5 Â-AAGTGAGCAATAGTAAACACAAATCAAAC-3Â and 5Â-CGTTACATTATGCTCCATTGACTAACAACGA TG-3Â, were constructed based on fragment DNA sequences of ... FEBS Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis H...

Ngày tải lên: 20/02/2014, 01:20

... Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 746–754, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP What lies beneath: Semantic and syntactic analysis of manually reconstructed ... of ver- batim spontaneous speech (Harper et al., 2005). While this limits the reliability of syntactic obser- vations, it represents the current state of...

Ngày tải lên: 20/02/2014, 07:20

... 41144128 ê 2005 FEBS 4125 Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata Takehiko ... ecdysone receptor (EcR) and ultraspiracle (USP) of the coleopteran Colorado potato beetle Leptinotarsa decemlineata (LdEcR and LdU...

Ngày tải lên: 07/03/2014, 21:20

... proliferation and induces the death of HPV-positive and HPV-negative cervical cancer cells through an androgen- and estrogen-receptor independent mechanism Roma A. Giro ´ n 1 , Luis F. Montan ˜ o 2 , Marı ´ a ... Dehydroepiandrosterone inhibits the prolifera- tion of HUVEC by enhancing the expression of p53 and p21, restricting the phospho...

Ngày tải lên: 16/03/2014, 00:20

... 5Â-GAAGTTAAAGATACAATGATTCAGCTC 5Â-GAGCTGAATCATTGTAACTTTAACTTC-3Â 48 N302D 5Â-CATTGTTGAAGACATCAATGTTG-3Â 5Â-CAACATTGATGTCTTCAACAATG-3Â 43 N302F 5Â-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3Â 5Â-GCTGCAACATTGATGAATTCAACAATGTAAAG-3Â ... 5Â-CAACATTCCTTGTCATCGAACCAAACTC-3Â 58 R103M 5Â-GTTCGAGAACAATGAATGTTGTGTTC-3Â 5Â-GAACACAACATTCATTGTTCTCGAAC-3Â 55 R103E 5Â-GAACACAACATTCTCTGTTCTCGAACC-3Â 5Â-GGTTCGAGAACAGA...

Ngày tải lên: 17/03/2014, 10:20

... Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain Damien Vanhoye, ... GWMSKIASGIGTFLSGMQQa DRS B1 AMWKDVLKKIGTVALHAGKAALGAVADTISQa DRS B2 GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa DRS B3 ALWKNMLKGIGKLAGQAALGAVKTLVGAE DRS B4 A...

Ngày tải lên: 23/03/2014, 17:21

... Project 037 /VIE/05 Present at CARD Workshop, Bac Kan, April 20,2010 Project Title: Establish nurseries and training to effectively propagate high quality trees and trial plantation models of Macadamia ... September in all the nurseries and trial sites in three years (2006-2008) Ongoing informal training also continues in all of the partic...

Ngày tải lên: 21/06/2014, 04:20

... of the year- ly carbon budget for a mature Scots pine stand, further analyses are warranted to examine inter-annual changes in NEE. Soil CO 2 efflux and NEE using the SECRETS model 41 The stand- scale ... CO 2 efflux and net ecosystem exchange in a 70-year-old Belgian Scots pine stand using the process model SECRETS David A. Sampson,...

Ngày tải lên: 08/08/2014, 14:21

... the barriers and facilitators in more detail. All interviews were audio taped, transcribed verbatim, and analysed according to a systematic approach. Results: All possible barriers and facilitators ... 5:64 http://www.implementationscience.com/content/5/1/64 Page 7 of 9 RESEARC H ARTIC LE Open Access What are possible barriers and facilitators to implemen...

Ngày tải lên: 10/08/2014, 10:23

... the literature was undertaken to understand the types of quality and safe team initiatives, the evidence about their impact, and the barriers and facilitators to estab- lishing teams and team initiatives. Methods Data ... understanding of how these teams are established, the barriers and facilitators to establishing and imple- menting teams and team initiatives,...

Ngày tải lên: 10/08/2014, 11:20

... 12:172-175. doi:10.1186/1471-2229-10-37 Cite this article as: Li et al.: Potential chromosomal introgression barriers revealed by linkage analysis in a hybrid of Pinus massoniana and P. hwangshanensis. BMC Plant Biology 2010 10:37. Submit ... natural hybrid of P. massoniana and P. hwangshanensis. This genetic map is determined by using megagametop...

Ngày tải lên: 12/08/2014, 03:21